GenePrediction:GLEAN_7926 Details

Name: GLEAN_7926
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2176926..2175403 (- strand)
Length: 1524
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2176926..2176356 (- strand)
Length: 571
Type: CDS
Source: GLEAN
Position: GCSC_113:2176262..2175403 (- strand)
Length: 860
>GLEAN_7926 class=GenePrediction position=GCSC_113:2176926..2175403 (- strand)
ATGGCCACAGCCACGGTGGATGCAGCGGGCGCTACCGCGACCGACAGTGACCCCGTTGTCGCTCGCTACAACGTCTTTCT
CAAGCCACAGCTGCCGGCCCACCAGAAGCTGCTGGTGCTGCAGTACCCCAACAGGGTCGACAAGACCTCTCCGCTGACGA
GCTCCGGACTGTCCCCGACCGAGCTGCGCGTGAAGCAGGCCTCCGGCATGGTTGAGATCGACATTCCGCTCGACTACAAC
AACGCCTACGACCGCACCAAAGGCATGGCTTGGGGCGGCGCCCTGGCCAGCTCGACCAAGGCCAAGGCTGGCGGCAGCCA
CGGCCTGGCCGGCGGCTTTGGCGTCGGCGGCGTGCAGGGCGCTCGGGGGCGGGCGCTGGCTGGAGCAGGAACGGCTGGCG
GGCGCTCAGTGTCGACCACAGCGGCCGGTGGCGGTGATGGACACTACGGGTCGCTGGACTGGTCAGAGGCCATTCGTCAA
GACCGTGTCCTCCGGTTGCAGACGCTCGGTGGCATGTGTCCGCCGACACGGACAGCCGAAGCCCGCTGGATGATTGGCGT
GTTTGATGGCGGTACGTTGGGCTGGTCGATTGCTTATTTGCCTTTCTCTTTTTTTTTTTTTTTTTCCCTTCCTTTCCCTT
CCTCTCTCCCTCTAACATCTACAGGAAACCTCCACCTGACACCCGTCAACTCGCTGGTTCATCTTCGCCCGCAGCTGCAT
CACATCGACGCCGAGGCGGACCTCGACCGCCAGAAACATCGCGACTCTGCCGGAGCTGACGGCGGTGCTGGCGGCCGTGG
CGCCGGCGGCCCGGCAGGCGGTCCCGTAGCTCGTGCCATCCACATGACTATCAAGAGCGCTGGCGCTGACGGCGACGAGG
TCGTCACTGAGACCATGGCCGATCGGCTGCGGGCCGTGCAGATGGAAAACTGGACGCGATTGACCTACGTCGGCGACGAC
GACGAGAACTCGTGGGACGTGTACAACCAGACGCTATTTCTGCGCGAGACTGCTGCTGCTGCTTCTGCTTCTGCTTCTGC
GGCTGCCAGCTCGGCTGCCTCGTCGACGGGAGCGACGGCCGGCGCCGACGACGACGACAAGGAGAAGAGCACAGACATCC
TCAGCGCGACCGACACAGCCGACGACAAGCCGCTCGTCGCAAAGGTGCCCTCGCTGCGGACGGCCTGGCAGGAGAACGAC
CTGCTGCAGGCCATCAGCGGAATCCAGAAGCCAGCCGACGACAGCTCGGAAGCAGCTGCCGCCGCAGCAGAGGTCGCTCG
ACAGACAGCCAGGCTTAAGGCCAAAAACAAGGCTAAAGCCAAGCAGAGACTCGAGGGCAATGCTGCCAGTTCGGCTGAGG
CTGTCAGCTCGGCCGCCGTCAAGCAAGAGCTCTCAGTTGCGGACGGACCTGCTCCAATCGCGCGGAGAGGACGGCCTTCC
GCCACTCTGCCACCATCTCGTGGACGTGGAGGCAGAACAAGACAGACCGGGCCAGGTCGCGGCTCGGCAATGGACATCGA
CTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62