GenePrediction:GLEAN_7928 Details

Name: GLEAN_7928
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2160398..2156531 (- strand)
Length: 3868
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2160398..2159939 (- strand)
Length: 460
Type: CDS
Source: GLEAN
Position: GCSC_113:2159850..2159584 (- strand)
Length: 267
Type: CDS
Source: GLEAN
Position: GCSC_113:2159510..2158506 (- strand)
Length: 1005
Type: CDS
Source: GLEAN
Position: GCSC_113:2158443..2157125 (- strand)
Length: 1319
Type: CDS
Source: GLEAN
Position: GCSC_113:2157069..2156664 (- strand)
Length: 406
Type: CDS
Source: GLEAN
Position: GCSC_113:2156592..2156531 (- strand)
Length: 62
>GLEAN_7928 class=GenePrediction position=GCSC_113:2160398..2156531 (- strand)
ATGAACGAAGACGACCGAATCATGGATATCTACAAGAAGATCGAGCGGGAGAAGATGTTGATCCAGGCAGCAAGCATGAT
GCGCCTGCAAACCAACAACGATGCTGTCCAATCAAAGCTCGACTCCCAGATGCGCGAAGGCCGGCGCAACCTGGAGTTTT
TTGAGGAGAAGTTGCGTGAATTCCAAATGCGACGTCTCGGCCAGGGCATGGAAAACGTGAGCCTTGGAAGTGGCAGTGGC
TCTGCAAGCGGCTCATTGCGACCCCTCAGCACCGATATGCACCCAGACAATGAAGGCCCCCCGGCCCCGCCGCCAAAAGA
CGCCTCGTCATGGGCAGACAATTCAACGCTGGCTTCCACCAACCAGCCTGGACGGCAGAGCGAGTTACAGTCTCCGAACT
TTTCTGTGTCTCCCGCGAAAATGTCTATGCCCAAGGCGCGGCCCAACTTCACGAAGCTTGGTGAGCCTGCTTCTTTTCCT
CTCCTCCTTTGATGTTTGCCCATGCATGCTATATCGCTGGTATCTTTCAGCCAACTGATAACTGTCAGATCTGATCAAAT
ACGACACGCCCTACCTTGGTCCGAGAATCCAGCACATGCTATCGCAGATACAGTTCAAACTCAATGTCGAAGAGCAGTAC
TTGAAAGGAATCGAGAAGATGGTCCAGCTTTACCAGATGGAAGGCGACAAGAAGAGCAAGACCGATGCAGCCTCCAAAAA
GGTCGAAAGCAAACAAAAGATTACCCTGCTGAAGCAGGCGCTGAGACGATACGAAGAGCTGCACATTGATATCGACTCTG
CAGACTCACCAGATGGTATGCCAGTGCTTTTTGCAGCAGACTTCATGCTCATGGCTCTGTGTTGGGGCACTATACTGACT
GAAACTAGATGACAGTGTCAACGTCGCAAACATGCGGAAGCCGCTTTCTGGCCAGCTGTCCATCCGGGTGATGTCAGTCA
AGGATGTCGACCATGCGCCTACTGGCCGCTTTAGCCGCGGGCCCGAGTCCTTCATTGCCGTCAAGGTCGAAGACAACGTG
GCCGCACGAACGAGGCTGTCAAGAACGGACCGTTGGGAAAACGAGTTTCACAACATCGAAGTTGACAAAGCGAACGAGAT
CGAGCTCACCGTATACGATAAGCCCGGAGAGAACGCCATCCCGATCGGCCTGCTCTGGGTCCGCATATCCGACATTGCGG
AGGAGATACGTAGGAAGAGGATCGAGGCCGAGATCAACTCCTCCGGCTGGGTGTCCGCAGACAAGATGTCTCGCGACAGC
GGCCGGGCCGCGCCACCCCAGTTTCCCACCACTCCGCAGACCCAATTTAGCCCGCCACCAAACGCGCCGGGGAGCTTCTC
ACCAACGCAGCAGCAGTCGCCCCAGACGCAAGAGGCCGGCGGTGAGTTCCCACAGCTGCCACAGCTGGCTCCCGAGCCAA
TCACCGGATGGTTCAATCTAGAGCCCACCGGGAAGATTCAACTGAGCTTCAATTTTGTACGCCAGAACAAAGACCGCCGC
CCGCTCGACCTTGGTCTGGGCCGCAAAGGCGCCATTCGGCAAAAGAAGGAGGAGGTGCATGAGATGTACGGACACAAGTT
TGTCCAGCGCCAATTCTATAACATCATGCGGTGCGCCCTCTGTGGTGACTTCCTCAAGGGTGGCGCGGGGATGCAGTGTG
AAGACTGCAAGTACACCTGTCATGTCAAATGCTATTCGAGCGTTGTCACCAAGTGTATCAGCAAGTCGAATGCCGAGACA
GATCCGGACGAGGAGAAGATCAACCACCGCATCCCCCATCGTTTCCAGGCCTTTGGAAACTACACTGCCAACTGGTGTTG
TCACTGTGGCTACTTGTTGCCGTTTGGCAAGAAGAGCTGTCGAAAGTGTTCAGGTTCGTCGGCCCTGCCATTTCCCCTGC
ATGCCGCCTGCCGACATAGACTTACCTTTCTGCAGAATGCGGCCTTACTGCACATGCTGGATGCGCCCATCTTGTGCCGG
ATTTCTGTGGCATGTCGATGGCTGTTGCGAACCAGATATTGGAGGGCATGCGGACGCAGAAGAGCCGCCAAAAAGCCTTG
TCCTTGAGCGACCGTACTTTACGTCCTCTGAAGCCGGGTCAGGCAGGCCAGCAATCGCCATACATGTCTCCAGGCGCGAG
CCCGAGCCTCTATGGTCCTGGGGCGGCGTCTCCTGAAGCTACAGAAGCAGCCAAAGCGATGTATGCGAGCCAGATGTCGC
CCAAGCACGCTGAACGGCCAGACCGCACGTCAAGCATATCCAGCTCGGCAGCAGCAGCAGCAGCGACATTGGCGATGTCG
GGATCCATGACGTCTCCGGGGGGCACAAAGGGTGGTTCGGGCGGATATGGAGACCCGTATGGAGCATTGCAAACGTCACC
TACCCAGGCATACGGTAGTGCGCAGCAGCAGCGGAAGTATAACCCTGCGGACTATGCCAACATCGGTGGCCAATATCCCC
CAAGCCAGCCGCAAGCGTCGCAGATGATGCCGCCCGCATCGTCTGCCGCCTTGCAGCAGCAGCAGCAGATGCCACCGCAG
CAGCAACACATGTATCAACAGCAGCCGACATCGCTCCAGCAAGCACCGCTGATGACGGAAGCTAACATCAAGCCAATGCT
TCCCGAACAGGCGGCGGCTGCGCCGTCGTCGGTGGTTGACCTCGTGACGGGAACGGCGCAGAAGAAGCCTCTCCCATTGG
CAACAGACCCAGGCACGGGTCAACGGATCGGACTCGACAACTTTAATTTCCTTGCGGTCCTTGGCAAGGGCAACTTTGGC
AAGGTGATGTTGGCAGAGACGAAGCGAACGCAAAAGCTGTATGCGATCAAGGTGCTCAAAAAGGAGTTCATTATTGAAAA
CGACGAAGTTGAGAGCATCCGGTCGGAGAAGCGGGTGTTCCTCGTTGCGAACCGGGAGCGGCACCCGTTCCTGACCAATT
TGCATGCGTGCTTCCAGACGGAGACGCGTGTTTACTTTGTGATGGAGTACATTAGAGGTGGCGATCTGATGTTGCATATT
CAGCGGGGGCAGTTCGGCACGCGGCGGGCGCAGTTCTATGCCAGCGAGGTGTGCCTGGCGCTCAAATACTTCCACGAGAA
CGGGGTGATCTACCGTGATCTGAAGCTCGACAATATTCTCCTGAACATCGACGGCCACATCAAGATTGCGGACTACGGTC
TCTGCAAGGAGGATATGTGGTACGGGTCGACGACAGGGACATTCTGTGGCACGCCCGAGTTCATGGCGCCGGAGGTACGT
GTGGGCGGTAGTGAGCAATCGGCGCAGGATATGCTAACAATTGCGACAGATTCTGCTGGACAAGAAGTACGGTCGTGCAG
TGGACTGGTGGGCATTTGGAGTGTTAATCTACCAGATGCTGCTGCAGCAGTCGCCATTCCGTGGCGAGGACGAGGATGAG
ATCTATGATGCGATTCTCGGAGACGAGCCACTCTATCCGATTCACATGCCTAGGGATTCAGTGTCGATTCTGCAGAAGCT
GCTCACGCGGGATCCGGACCAGCGTCTGGGCAGCGGACCGACAGATGCGCAGGAGGTGATGTCGCAGCCGTTCTTCCGCA
ACATTAACTGGGATGACATCTACCATAAGCGGGTGCAGCCGCCGTTCCTGCCGACAATCAAGAGCGAGACAGACACGAGC
AACTTCGACTCTGAGTTTACGAGCGTCACGCCGGTGCTCACACCAGTGCAGTCAGGTATGCAGCTTCTTAATTGGATGCT
TCCGTTGTCTGGATATGTAGCTAATCATTCCGGTGCCGCTACACAGTTCTGTCGCAAGCGATGCAAGAAGAGTTCCGCGG
CTTCTCATATACGGCGGACTTTGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62