GenePrediction:GLEAN_7929 Details

Name: GLEAN_7929
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2151197..2149124 (- strand)
Length: 2074
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2151197..2150886 (- strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_113:2150835..2150526 (- strand)
Length: 310
Type: CDS
Source: GLEAN
Position: GCSC_113:2150469..2150390 (- strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_113:2150325..2150014 (- strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_113:2149951..2149124 (- strand)
Length: 828
>GLEAN_7929 class=GenePrediction position=GCSC_113:2151197..2149124 (- strand)
ATGGGTCCTCTGCCGATCGTGACGCAGCTCCCAATTGAGGTTGCCAGCACCGACAGAGCGTTATATAGGACGGCGCAGCG
CCCAGCACAACTTGCATCTAAGCACTGGTCTTGGAGTTGGCTTCGTCAACAGACACAGAAGCTGCCTGTACTGCCGGCCC
ACTCGCGCCTGCTGGGATACACGCCTCTTGCTGTAACCGACGCGGACCTACAAGAGGCCCCTGCAGACGGCCCGTCCACC
ATGATCTTTCAACGCTTGGTCGAGAAGCTGGCCGTCGATGCCGAACCAGGCCTGACCACGGCCCAGCTGATGGTACGTTC
TCGTGTAGGCGCTCGACCATCGGACAGGACTGACACACACAGCTCACGAATAAAGACTTGAAGCCAGTCGAGCCAGAGCG
GCGCCAATGGGGATCCTGGAATTTTGTCGCGTTTTGGATCAGCGATGCCTTCAACATCAACACTTGGATGATATCATCGT
CCATGGTCGTCTCCGGCCTTTCGTGGTGGCAGTCATGGATCTGCGTCTGGGTTGGCTACCTCATCGCCGGCGCCTTTGTC
TGTGTGACTGGTCGCATTGGCGCCACCTACCACATTGGCTTCCCGGTCGTCAATCGCGCATCCTTTGGCATCTGGGGCAG
CTTCTGGCCGGTGTTCAACCGTGCTGCCATGGGTATGTTCTCTGACACTTCTACTTCTTGTTCTGTTATATTTCTGACTT
TAAAACAGCTTGCATCTGGTATGGTGTGCAGTCATATATCGGCGGAAAATGCGTCTACTTGATGATCCGAGCCATCTGGA
AGAGTTGGGTATGTGTCTATGAAGCCATGGCTTCTCGGTCTATTGCCTTACACCGACTAACTGTCCTGGCAGGACCGTAA
TACCATTCCCAACACCTTCTCGGTGGATTCGGGCACCACCACGGCAGACTACGCCTCCTTTTTCATCTTCTGGCTGGCCT
CGTTGCCGGCTATCTGGTTCCCCGTCCACAAGATCCGCCATTTGTTCACCGTCAAGGCCATCTTTGTGCCATGTGCCGGC
ATTTCCTTCTTCATCTGGGCTCTCGTCCGGGCTGGTGGTGCCGGCCCCGTCATCCACCAGAAGACCAGCCTCTCGGGATC
CACGCTCGGCTGGACCATGGTCACCGGCATCATGAATTGCATCGCCAACTTTGCCACCCTCATCGTCAACGACCCCGACT
TTGCCCGCTTTGCCCCAAGAGGCCCCGTGACGCCTTCCTCCCACAGCTTCTGACCATTCCCTTCAGCTTCGCGCTCACTA
GCTTCATCGGCATATTCGTCAGCTCTGCTTCTGTCGTCATTTACGGCGGCGAGCCGATCTGGGACCCGCTCGATCTGCTG
GAGAATTTTATCGACGACGGCCACTCCGGCCAGCGGTTCGGCGTTTTCATCATCGCGCTGGCCTTTGCCCTAGCCCAGCT
GGGCACCAACATTGCCGCGAACTCCGTCTCGGCCGGAACGGACCTGACGGCCCTCATGCCGCGCTTCATCAACATTCGGC
GCGGCGGCTACATCTGCGCGCTCGTCGGCCTGGCCATGTGCCCCTACAACTTGCTCAAGTCGAGCAACCAGTTCACGACG
TACCTATCGGCTTACTCGGTATTTTTGTCGTCCATTGCCGGCGTCATGGCGTCCGACTATTACGCCGTACGTCGTGGCTA
CCTCGAGGTTCGCGAGCTCTACGACGCCCGCAAAGATGGCCCGTACTTTCACACCGTCGGCATCCACTGGCGCGCATACG
TGGCGTACATTGCGGGCATCTTGATTAATGTGGTCGGCTTCGCCGGCGCCATCGGCCGCAAAGTGCCTGCCGGTGCCATG
TACATCTACCATCTCAATTTCTTCTGCGGCTTCCTGGTCGCCTTTGGCATCTACTGGCTGCTCTGCTACATCAAGCCTAT
TCCAGCCTGTAGCCCAGACGGCCGGTGGATGGAGGTGGGTGATGCAGTCAGTGAAGACTACAATGACAACGATGCTTCCG
GCTACCTGGACGAGGAACACGGACAACCAGACGGTAACAAAAGGACTTCACGTAAGCGCATTGTGCAGTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62