GenePrediction:GLEAN_792 Details

Name: GLEAN_792
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2156932..2157678 (+ strand)
Length: 747
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2156932..2157327 (+ strand)
Length: 396
Type: CDS
Source: GLEAN
Position: GCSC_97:2157391..2157481 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_97:2157548..2157678 (+ strand)
Length: 131
>GLEAN_792 class=GenePrediction position=GCSC_97:2156932..2157678 (+ strand)
ATGACTACAGAATTTGTCGTGGAGGTTGCCAATGGATCAGACCCTACGTTCCGATCCTACAAGGGCAACCAGGCTAGTGA
ATACAACGAAGGTCGCCCTGCCTACGCACAGGAACTGTACCGAGACATACTGAAGTACCACGATAATGCTGGACTGCGTG
GCATTGTTGTCGATGTTGGTTGTGGTCCTGGGAGAGCGACACGCGAAATTGGACGTTTCTTCGACCAGGCAATCGGCATC
GACCCTAGTGAAAATATGATTGAGACGGCCCGGAGGGTCGGTGGCACGACACAGGCCAATAAACCAATCAAGTATCACGT
CTCTGCTGCTGAGAAGATAGCAAGCCTCGATGACGTGCCCCTTGGCGATATCGATCTCATTACAGCAGCGACAGCCGTGA
GTGCTTTCCATTGCCAAAGTCTTTTACCTTGTATTAACTTTCTCCACTAGGCCCACTAGTTTGACATGTCAGAATTCTGG
GACCAAGCTGCCCAGCTCCTCAGGCCTAGTGGCACGGTCGCTCTGTGGACGACAGGTTGCTTTTATGCGCGTGAGTGACC
CAGATGGCCAGACATTGAGCAGAATCGGTTGTGTTAATGCAGAATAACATCTACAGATCCTTTGTCCGAGAATGCAGCGG
AGCTAAACCGTATCATGCGCCGATTGGAGTGCGATGAGCTCGCTCGCTTCGAAGTTGCGCGCAACATCCTCTCCCGCACA
CTCTACTATGATTTGACACTCCCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62