GenePrediction:GLEAN_7930 Details

Name: GLEAN_7930
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2147475..2146125 (- strand)
Length: 1351
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2147475..2146974 (- strand)
Length: 502
Type: CDS
Source: GLEAN
Position: GCSC_113:2146923..2146719 (- strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_113:2146581..2146125 (- strand)
Length: 457
>GLEAN_7930 class=GenePrediction position=GCSC_113:2147475..2146125 (- strand)
ATGACAGCACTAACGACGACGCCGTCTGGGACACCAGAGCAGACAGAGCGGGAAGGGCCGACAGAGCCGACAGAGGCATC
CGCCCCAGCATCGCCTCTGGAAGAGCCTGCAACCAGAGAGGACTCGGTCGATGAGGACAACTCGCCGGGAGCCTCTGTGG
ACAATGATCCACCGGTCGGATCCGACGCTGAGCCGGTCGAGCACCACATCCTTGCCGATGACGAGTCGACCGACGAAGGC
TTAGCGTCCGAAGCAGCCTCGGCCGGCTCGACGTCTCTGGCGTCGAGCGTGCGCGACTACCATTTTGAGAACAGCCGGCG
GTACCACAAGTTCCAGCAGGGACTGTACCAGTTTCCCAACGACGAGCCGGAACAGGAGCGTGAGGACATGAAGCACACCG
TGGCCATCCACCTGCTGGGCGGAAAGCTGCACACGGCGCCGCTCGAGAACCCGCAGCGGATCCTCGACATTGGCACCGGC
ACCGGCATCTGGGCTATAGACAGTGGGTTGCTCCCTTTCGCCTGGGCTACAGGCTTGCTGATGACAGCACAGTGGGCGAC
GAATACCCCGAGGCCGAGGTGACTGGCATCGACCTGAGCCCGATCCAGCCGCAGTATGTGCCGCCCAACGTGCGGTTTTA
CGTCGAGAACGCGGAGGAGCCGTGGGTCTACGACAATGACACGCTCGACTTTATTCATCTGCGCAATATGTCGACCGCCA
TTAAGGATTGGCCAGGTCTGTTTCAGCGGGCGTTCCAGTATGTTTTTTTTCCGCCTTATCCTTTCTTCTTTCTTCTTTCT
TCCTTCTTTCTTTTCTTTCTTTTTTCTTCTTCTTTTTTCTGCTTTCTTCTCCCTTTCCTCTCTCTTCCTTCTCCCCTTCT
CATCCAACCCACAGGGCCCTCAAACCCGGCGCTTGGATCGAGCTGCCCGAGTTCCGCTGGGAGTACGGCTGCGACGACGG
CACGATGCCCTCCGACTTCACGCCGCCCCAAATGGTGGCCAACATCCGCGATGGCCTGGCCAAGTTTGGCGTCGACATGC
ACGCCACGCGCACAAACCCAGACCGTCTGCGCGCCGCCGGCTTCGTCAACGTGAGCCACGACGTCAAGAAGGTGCCGGTC
GGCCCCTGGGCCAAGGACCCGAACCTCAAGACCATCGGCCTGTACAACCGCAGCGTCATCTACGACGGCCTGCAAGCCAT
CACCGTCGGGCCCTTTACTCGCGGCCTCGGGTGGAAGCCGGAGGAGGTCGAGGTCTTTCTGATCCAGGTGCGGCGCGACC
TGAAGAACCCGTCTGTCCACTCGTACGTCTACTTCCACTCGCTGCGCGCCCAAAAGCCTGTGTCGAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62