GenePrediction:GLEAN_7931 Details

Name: GLEAN_7931
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2136720..2134859 (- strand)
Length: 1862
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2136720..2134969 (- strand)
Length: 1752
Type: CDS
Source: GLEAN
Position: GCSC_113:2134891..2134859 (- strand)
Length: 33
>GLEAN_7931 class=GenePrediction position=GCSC_113:2136720..2134859 (- strand)
ATGGACTCCTCGCCTAGAAACAAGACCGCCGAGAACGCTCTGCCTTCGGTGGCCGGCGTGAAGCGTTCGGCACCGACACT
CCTTCCACCCTTCGAACCGCTGTCCTCCTCACCTGGACTGCCACGGCTCGTCAAAAAGGCACGGGGAGGCTCGGCAGCAC
CCAGTTTCAACAATGCTCGCACCAAGTATCCCACGCCGGTGCCGACGTCCAGCACAGGCATCCTGTCATCCTCGCCACCG
CAGCGTGGCGGACCACGTCCTGTCTTGCAGCGTACCGCGTCTACCTCGGAGCGTGCTCCCCTGGGTGTTGTACCGACGGC
CGAGCTGAACGAGAACGGCGAGACAATGCTTATGGGCCGCTCCAGCAACTCCTCGCACTACCAGCTGTCCGCCAACCGGT
TGATCAGCCGCGTTCACGTCAAAGCACGATATGTGCCGGCTGTCGAGACCCTGGAGCCAAACCGAGTAGAAATTGTGTGC
TGTGGATGGAACGGACTGAAGCTGCACTGCCAGGGGCGGACATGGGAACTGGGCAAGGGCGACACGTTCACGAGCGAAAC
CGAGAACACGGAGATCATGCTAGACGTGCAGGATGCCCGGGTCCGTATCCAATGGCCCAAGAAGGATCGCAATGAATTGC
TTGGCGGCATCTCCGACTCATCGTGGGACGACTCTCCGCGCTCCAAAATTGTGGCTAGACGCGTTCCTGGCACTCCAGGC
GCCCCAGGTGCATCGCCGCTGCAGTCCAGCCCCCTGCGTGGAGCACGTATCGCGTCGCCCGTAAGCCCGACGCCGGCCGG
TATCCCGGCATCTGGAGCTAGCCTGCAAGCCCTGTTGGCTCAACAGCTAGGCAGTGATGGAGAGGATGAAGACGATACCG
GCCCGGCAATCCAGATTTACGAAGATGGCAGTGCCGACGAGCTCGAGCTGCCGGTGAAGGGACCCAGCCCCGGAGACGCG
AGCTTTGCAACGGACGTGATGGACAGCTTCTCAAGCGAATTAAGCGAGCTCCCTTCAGACGACGAAGACAACAACCAGCA
CGACCAGAACAACGACGACGACCTCGACGAAGAAAACGATCCGATTATCCACTCCTTCGGTCCCTTTGGTGCGAATCTGT
CCAGCCGCTTCGCTTCGGTAACAGCACGCAGCCCACAGATTGAGAGGCCACGGCTGAGCCGCATTCTGTCGGAGGACGAC
CTGACTATGACCGCCAGCTCCAGAGAGGCCGATGCCGGTAAGAAGGGCATCCGACGTCATCCGACAACAGGCAGGTCCTT
GTCACCGCATGCACAAAAGCAGGAGCGTGATCTGGCAACAGAAGACTTGGACGATGTTGACACCGACAAAGCGCTGCTAA
CAGACGGTGTGGGGCTGGGAATTTCGGTTGCCACTGAGAACGCCAGCAGCCTTGCGTCACCAGTAATTAGCAGCAATGTG
GACATTGACACGGTGCGAAACCATCTGATCAACCAGCTCGCCTTTTCGCGTCTGTCGTCGAGCCCATTGTCTACGATTAT
GAGCAACCTGCCGGCAGAGGAGCGGCGCGACCTGACACGCGATGGATTGCGCTACATCATCGATGGCACCAACTGCGTCG
GCGTGATCCTGCGGCAAGGCAAAGATGCTGCTGGCCAGGCTTTGGAGAGCGAGTACTACTACATTGCCGATTTCGATGAG
GACCTGTCTCGGAAGGCGGTCATCGATGGCCTGCGCAAGCCTAGTTTGCGAAACTGCCGCAAGCAGCACAAAGTAAGACC
AGGATGCCATGATATGCTAGTAGAAGTGGCTCGAGATGTGGGAAGATTAGTGACTAACACTGCATGCAGCAATACTACTG
GAAAAGGCCACGAACTCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62