GenePrediction:GLEAN_7933 Details

Name: GLEAN_7933
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2128313..2123187 (- strand)
Length: 5127
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2128313..2124347 (- strand)
Length: 3967
Type: CDS
Source: GLEAN
Position: GCSC_113:2124275..2123477 (- strand)
Length: 799
Type: CDS
Source: GLEAN
Position: GCSC_113:2123196..2123187 (- strand)
Length: 10
>GLEAN_7933 class=GenePrediction position=GCSC_113:2128313..2123187 (- strand)
ATGAGCCGACCAAGACCAAAGGGCCGGCTTCCGCCCCCCGGCGCGGCAAGCTTTGGTTCTATTGGCCCTGCTGCCGGCGG
TTTTGGTGGCTTCGCCCCCGTGCAGAACAAAAGCGGCCTTGCCTACCTGTCTGACCGGCATGATCTGTCTGGCATCTCAG
ACGCAAATGCGGTTGTGCAGTTCAAGAATCTGCTAAAGAAGGACGGCAAGACGAAAGCAAGAGCACTAGAAGAATTGGTC
GCTTATGCGCAGGCACATTCCTTTGAGAGCGGCGGAGTAGAAGACGCCATACTGGAGGTTTGGGTACAGCTTTTTCCCCG
ATTATCTATCGATAGCGAGCGAAAGGTCCGAGAGCTCGCCCACAATGTACAGTTCGAATTCATGAAGTCTGCAAAAAGGC
GAATGGAAAGACACGTTCCCAAGATTGTCGGACCGTGGCTTGCGGGCGTCTACGACCGCGATCGGGCTGTCTCGCGGGCC
GCAAGCGATTGCATCACGTCCTTCCTGAGCACGGAAGAGAAAACCCGGTTGTTCTGGAAGAAGTGCAAGCTTCAGATCCT
GGAGTATGCCATTGCGGCCCTGAAGGAGACGCCCACGACCCTGAGTGACATGCGGTCCACCACGGAGGAGGATGCCGCCT
TAGTATCACACCGCGTCTTATACAGTAGTCTTTCGCTCGTCATGGCCCTGTTGAGGAAGTTGGATGTGGCGGACACGGAT
GAGCTGCAAGACGCCTATATCCGCCTCTTCTCTCTCGACCGGCTCATGGGCTGTGCAGTCTCCAAAGACAGCCACGTCCG
GAGGGCGGTGTACGAGGTCATCAAGGCTGCTCTCGAAATAAGACCGGTCTTCCTGGAAGCACAGATGGAACGGCTCACAC
ATACGCTGACACAAGATGCTGTCAAAACGAGTCAAACGGGATCGGTTGGGGTGTTGATAGACCTGTTGACGTACGTCTCA
AAGACGCAGCCGCAAATATGGGACGGCAAGGTCCATCCTCTCACACAGCTTCGGCCGTTAATGGAAAAAGGATCCCAAGG
GGATCTATCACACAACTTCTGGCAGAACCTAGATGCGCTACTCAACTCTGTGCACCCGAGCTGCCCAGGAAACATTTCCC
AGAAAGAGGCTGCCAATATCCTGATATCGTTCAGGACCGGAATATCCCGACGAGAAGAACCAAGGAGCAACGCTGTGAGC
GGCTGGACTGCTTACCTTTCGATGGCCAAATATCTTATCGGCACAGTGGAACCGAAAGAAGCAATGGCTGGACTTGCCGA
GACTCATATATTGCCCCTCTTTGGGCATTATGTGTATCCACCAGACAAGTCGGTCTGGAGCACGGGTGCGCAGCTGCCCA
TCATCACAAGGGCATCCCTCCTGTGTTGCCGGCCAGTCTTCCCCGACGTCGTGGAATCGGCGCGGGCTGAATGGACGAAG
CAGTCGGCCGCTCTGGTTGCACGGATGTGCAATTCTCTGCCAGAGGTGTCAAAGGATTACGCGCGCTCGCAGCAAGAGAT
TGCCAACGAGGGCGATCGGTGGTTTTCGTTGATACACGACGTACATCGGACGGTGCAGACGGCGGCATCTGCATCCAGCG
GCCCGGCCAACTTGGTCGAGGATGTGCTGCTGAAACCGACTCTGGATCTCGTCCGCAGCGCCGCCGATCTCCTCAAAAGA
CGAAACTACAAGCCGTTTGGTGCTGCGCATGTCGTCAGCACGGCCTTTGCCCAGGCCTCCCACATTCTTCGGCGCGAGGG
CCGAGATGTCGCAGAGGCTCTTTTCCCAGTACAAGATAAGAATGAGCTTTCCCTGCTGCTCGCATCTCCGTCAGCACCAC
AGCTCCTTTCGGGCTTGCGGGCCATGGCAAGCATTCCGGAGTGCGCAGAGCTGTACAAGTCGGCATTCTCGGCCGTCATG
GTTCTTCTGCTCGAGAGCACTGATTCCGAGACGACGGCAAGGCACATCACACTACTCATCAGTGACACGTCGGATTACGC
TGCTTCAACAAGCCAAAGCAACGAGGCGCTGCAGACATGTCTGAGGAAGTTGTGCTTCGATACGGTCGCAAGAAAGCTCT
CGAGCTGGGACCTTTTCAGAGCGGCATTTGCATACAATGCCTTGTCGCAAACGACTGGCAAGGCTTTAGCATTTGATGTT
GTACAGGTCCTCGGCACTCCAGACGTAGAGGTGGGAAGCGTCTTGACGGCCTTGGAAACTATTGCAAGCAAGAACCCCGA
ATTTCTGCCACAGGGAGAAACACATACGCTGGACCTGGTCACCAAGCTGCTTGCAGTAACGGAGATCAACGACCCTTTGC
TGTCCTCCAAAGTCGAGTTACTCCGCTCGCTCATCGGTACACACTCCAAAGGAGAAACACCTCTGATCAAGATCATCCAG
GAGAACCTGGACAGCACAGGGCCGGATTCTTTAGAGATAGACACGCTTGTTGAGCAAGCGACGAGCATATCGAAAAGCGC
CACAGCAGAGGAGAAAGAGAGCCTTTTCCCGAGCACCAACATTTGGATGAAAGAATTGTTGCAGTTCCTGCAAGAAGACC
TTGACCCGGCACTGTCTCTTACGAGTCGACTCGGCGGGGCCTATCTCCTGGCACACGGATTTCCAAAGCAGGCCAATACA
GGACCGATCAAGCGCGACCAACACGGGCAGTCGATTCCGGCCAGGATGGCAGCATACACACTGAAGGTTTTGGAGGATGG
GTTTGACCTTTCCTCTCTCCCGAAGACGCTCGGCGTTGAACTTCTGTATATGCTCTATCTGGTGGCAGAAATCGGGTCGG
ACCAGATCGCTGTAGCCAGCTCGAAGAGTCTCTGGGACGCGCTGTCTGACCCCTGGGCGGCGTCTGTGGCAGAAGACACA
GTCTCCCAGATACGCGCGCTGCTAGCTAAAATCGTCGGCGGCGCACAGGGCGAGACGATCTGCCAGGCACTGATCGAGAC
GATGCTTCGGCAAACGACCAATGTTTCAGCGCTTTCCATCTACACGGCACGAGCTCTGAGTGAGCTGCTGCAGACAAAGG
TGGACAGCCGTGGGTTCACGCCAGCCGAGCAAGAGCAGGTTGCCAAACTGAACATATGGAAGACGAGCCCCGAGACAGCA
TTGGGGGCGGTGGCGGTTCTTACTGGCTACGGCGAGCTGCTAGGGCCATCCAAGACGGTGTCGACGTTCTGCAACCGACT
TGTCAGCGACGTGGCGGGAGCCAAAGCGGACAGCGAGTCGACGCTGTTGACGCTGGTGCTGCTTAATGCATGCATGTCGG
TGTACGAGATGGGCGAGCTGCCGGTTGCGACCAATCGTCTGGTGTTTACGGTGAGGCAGATGACGACCTGGTTTGTCACG
GAGGAGTCGGACAGCGACGAAGACGAGGAGGAAGAGGAGGGCGAAAGGGGGGAGAAGATCAACGAGAAGCTGGTAGCCAA
CTTTCGTGTGGCCACCGAGAGCTGCCGGGCACTGCAACGTCTGCTGCCCTGCATCAAGGACATATATGGGCCGCACTGGG
AGCGAAGTATAAAGTTCTGCGTCGAGCTGTGGACTCGGGCTGCGGAGGAGCCTCAAGACTCGAGCCTTTCGTGCGTGCAG
GCGTCGCTGAAGCTGATGGGAACACTGGAGGCGATGGAGGAGCCCAACGACGATCTCGCAGACGCTCTGCAGATGTATAG
CGGACCGAAGTGGCAGGCGATGTTGGGCCTGCTCTCAGCTAAGAGGTCCGAGGCGGGCCAGGCCCAGGAGATCGTGGACG
CGCTGCTCTGCCGGATGACAAGGAAGATGCCGCTGGACCAGGTCAAGGAGACGAGCGGGCTGTACGGACTGATGGCGTCG
GAGTCGCGCGAAGTGCAGACGGCCGGGTTCAACATATTGCACCGGGCGATCCCAGCGGCCCAGGAGGAGCTGTCGTTCAA
CGTGATCCTGGAAAAAAAGGAAAGGCACGGCTGCCGGACGAGCTGCTGTCATTGCTGCTGGACGCGCCAACGCTGGAAGA
CTACGCAGACGATGTGCTGGCAACGTTCCCGACAGCAGTACGATCGTACCTGCTGTCGTGGCAGCTGGTGTTTGACGCGT
TCAGCAAGGCGTCGGCCAAGGTGCGCGGCGACTACGGAGAGCAGCTGGGCACGGCAGGCCACCTGACAAGCCTGCTGGAC
TTTACGTTTGACGTGCTGGGCCACTCGGCAGCACATGCGCTGAACCTAGACAAGGCTGGATATGGGGCAGCGCAGATCAC
AGGCTACAACATCACAAACGGCGAGGCAGAGACGGACGAACGCAACATGCAGTGGCTGCTGGTGCACCTGTACTACGAGA
GCCTCCGGTACCTGCCAGGGTCGTGTCGGGCGTGGTTTGCGGCATGCCGATCGAAGCAGACGACGCTGGCAGTGAGCACG
TGGACGGCGCGGTACTTCTCGGCGATCCTGACGGGCGACGTGCTGGACGACGTGGTGGCGTGGGCAAGCTCGCAGGAAGC
CGAGGGGGCAACCGGAACGGACGAGAAGGCACTGCAGGTGCGGGTGAACAAGGCAGTGCGCGAGGTGGTGGCGAGTTACG
AGGTGGACGACACGGAGGCGTCGATGGTGGTGCGGCTGCCGGAGAACTACCCGATCGACAACGTGGTGGTAGAGGGCGTG
CACCGGGTGGCGGCGAGCCCGAAGAAGTGGCAGAGCTGGATGATGATTGCACAGGGCGTCATCACGTTTTCCAACGGCAA
TATCATCGACGGGCTGCTGGCGTTCCGGCGGAATATCGTGGGGGCGCTCAAGGGACAGACAGAGTGTGCGATCTGCTACT
CGATCGTGTCGGAGGACAAGCGGATGCCGGACAAGCGGTGCTCGACGTGCAAGAATCTGTTCCACCGTTTCTGTCTGTAT
CGGTGGATGGAGACGTCGCACAACAATACGTGTCCGCTGTGTCGGACGAGGATCACGTTGAATTCGGATAGGGATCGGGA
GAGGAGGGGTGGGGGGAGGTAAGGGAGAAGGGGTAGGAGAGGAGAGAGAGGAGGTCACAAGGAGAGAGTAGGGCAAGGAG
GGAGAGGGACAAGAGAGAGGAGAGAGGAGAGGGGGACAAGAGAGAGGAGAGAGGATAGAGGAGAGACAAGAGTATAGCCT
GGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62