GenePrediction:GLEAN_7934 Details

Name: GLEAN_7934
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2121565..2118353 (- strand)
Length: 3213
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2121565..2121527 (- strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_113:2121333..2121155 (- strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_113:2121040..2119176 (- strand)
Length: 1865
Type: CDS
Source: GLEAN
Position: GCSC_113:2119119..2118353 (- strand)
Length: 767
>GLEAN_7934 class=GenePrediction position=GCSC_113:2121565..2118353 (- strand)
ATGGACGGCCTTTCGCGAGCCGAGTATCCCGGCATGCTGGTGAGCTCTCCCACCACCCTCCCCATACCCTGTGCTGTCTG
TCTGCGTCGTGAGGGCCTACTCTACCAACGCACCGCCGTTCCCGCGATATCCGGCAGGCCGGAGCCTCGTTTATCGCGTC
CCCCTCTCTACCTCACCCCATCTCTCCTTTTGCTTCTGTTTGGCGAAGCTAATGTCGAGCTCTGTCTTGTAGGCCAGCTT
GCAGCCGGGCCTCGCCGTCTTCGTCCTCCAAGAACGTGCCAAGCGGATAGGGAAAATCAACCAGGAAATCGCCGACTGGC
TGTTGGAACGACGAAAAGTCGAGGAACAATATGTCGCTGGTCTGAGGAAGCTTCTGCTTGTCAAGGCGCCAAATTCGGCC
TCTGAGCTCGGGTAGGTCAAGACACACACCTCTGGACACGATCCCGGCCCGGTTTCCCCTTGTCGCGACCGGCTGGGTGG
CGTGTCTTCGGCGTCGCTCTACTTTCTGACATTTCTCCTTCGCAGCGTCTTCCAGCCGGCATGGGAGTCGATCCTGAACG
CCATCGACGCCGTTGCGAACTCCCACCACCTGTTCAGCTCAAGGATCGAGAAGGATATCGAGGTGCCGCTGCGGTCCTTC
CAGAACACGAAGGAGATGGGCAACCTGACCACGATATCGGCCAACCTCAACCTCGTGGCCAAAGAGCTCGAGGACGCCCA
GGACAAGGCCGACAAGCTCAGCAAGAAAGGCGGCAAGACGAGCAGCCAAAAGATGGACGCCGCCACCCAGCGGCTCGAGA
GCGCGTCGCAGCAGTGGGACTCGCAGGCGCCGTTCGTCTTTGAGACGCTGCAGGCGCTCGACGAACAGCGCACCAACCAC
CTACGCGACATCCTGACCCAGCTGGAGACACACGAGGTCGACCAGACTTCACAGAACCAGGCTACGGCTGAGGCGCTGCT
GAATGTCATCCTCGAGATCAAGACCGAAGACGAGATTCAGGGCTTTGCCCAGCGCGTCACCGCTGGCCGACCGAAGACGG
AGAGACGCGCCGCTTCGCGACAGTCCACCATTCCGGGATCCAGCAACAGCTCGTCGCATCCGTCGCATCCATCGCATTCA
TCGCACACGTCCCCGTCCTCCCACCCGCCTCTGCCTCCCGTGCCACAGCAGCACCAACAACAGTACCAGCAGCAGCTGCA
GCAGCACCATCACCAAAACTCAACGCGCAGCGACGATACCGTCTCGGAGCACTCGGGTCGCAACGACGTTCCGACAGAGT
CGAAATTACGCAGCCGCCTCGGCACCATGCTCGGACGCCGGCGGCAGAGCGTCCACAGCGGCTTCGGACCCTTGTCACCG
GGCAAGGGTAGCAGTTCCTTTGGTGCTCGGCCGTCGCAGAGCAGCCACGGCCGTACGATATCGCCACGCGCGTCCTCGAA
CAATCTGACGGAGATGAACCACCGCCTGTCATCTCTCGCCGAGACGCCCGGCTCGCCAGAGCCGCCCAGCACGGCTGAGT
CGCACGTGCTTTCGGCACGCGAGGGGGCAACCAACGGTGTCAACGGCAACCACGGCGCTCACGGTTCCAGCGGCACGAAT
GGTTTCGGCAGCGATGTGTCGGGCGGTGCAACTGGTGCCTCTGGTGGTGGCGCGAGAGCGGCAGCTGCAACGATGCACGG
GATGACGGCAGACGACATATTCGGCGTGCCACCGCCGCCAGGTCCGCCTCCATCGCAGCAGCAAAAGGCAGCGGCAGCGG
CAGCGGCAGCGGTGGCACCATCGTCGCCAACCAAGGATGCCGAGGGCTTCACCATACCGGCGCGGCCGAACGATCCGATC
TCACAGGCGCAGCGGGACGCAACGGCCGTGGCACTGGGCGAGGATGGTGAACTGGCTTTCAAGCTGAACATCCAAGAAGA
GCCTGTGGCGGACGAAGATGCGGATGCCAAGAAGGCAGCCATGTCCAACGTGGCCAACACGCTGACGATGGCGATGCCAT
CGCGCAAGGGGGGAACAGTGCGCGGCCGCCGCGACGTGCGGAACACGATCTACGTGCCGTCGATGCCGGTGCCAGACCTA
CCGACGAGCAGCAGTCCAAGCCTGCGGCCGACCAGTCCGACGATTTCACCGCCAGGGTCGCGGCCAGCAGCCGTGGCAGC
GCTGGCGTCAGAGAACAGCATCGGCAACGCGTCGGACACGCAATCGATCCGGTCGGCAACGTCGCTCGGCGGTCTCGCAC
ACCTGAAGCATCCAGACATGTCGGGCCCAGGGCTGAGCACGTCTGTGATCGAGACGGTGTCGGCCAGCTTTGAGGACGGC
GAGCTGAAGCTGGCCAAGATTGCGGGCGAGATTGCGTTTGCGTACAATCCGTCATCAGCGTCTGTGAAGGGTGAGTGTTT
TGTTTTGTTGCTTTAGTGGTGTTTCATGCTGACCGGCCAGACACAGAAACGATTCGGGTAAACAACATGGAGCTGCTCGA
GGCCATTGGGCCCAACCGCATCTTTGTGCGCAACACGACGGCAGCGGACACGTTTGAGCTGAACACGACACATCTGCAGG
CACACAAGCCGGCGGTGGGCTTTACATTCCGGGCGCTCGGTGAGAGCGCGACATCGCTGGGCAAGCACTGCCCGCTGGTG
GTGAAGCCGGTATGGAAGCCGACGGGCGACAAGCTGGGGCTGCTGCTGCAGTACCGGCTTAATGCAGAGGCAGCAGCGAC
GATGTCAGGACCGGTGACGCTGCACAACCTGGTGCTGATAGCGACGTACGAAGGCGCGCGGGCCAGCGGAGCGCAGACGA
AGCCGACGGGCACGCACATCAAGGACAAACACCTGGTGTACTGGCGAGTCGGCGACGTCACCCTGACGGATACGTGGGCC
AAGATTGTGTGTCGCATTCTGGGCCAGCAGGGCGGCGAGCCGCAACCGGGACACATTGAGGCACGGTGGGAGTACGCGAT
GCCGGCGGTAACGGAGAGCAGCAGCAGCAATGGCAGTGGCATCGGGATCAGCATCAGTCAGCTCGAGTCGACGGGCCACG
GCAAGGGCAAAGACCGGGCAGACGAGGCTGACGACGACGAGGCTGACCCGTTTGCCGACGACATTGCGGTGGTGAGCTCG
AAGCCAGCCGACAGCGGAAGCGATGCAGGCGACAGCTGGGTGGAGGTGCCGACGGTGCGGCAGATTGTCAGTGGACGGTA
CGAGGCCAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62