GenePrediction:GLEAN_7937 Details

Name: GLEAN_7937
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2111939..2111231 (- strand)
Length: 709
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2111939..2111864 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_113:2111809..2111372 (- strand)
Length: 438
Type: CDS
Source: GLEAN
Position: GCSC_113:2111313..2111231 (- strand)
Length: 83
>GLEAN_7937 class=GenePrediction position=GCSC_113:2111939..2111231 (- strand)
ATGGCCACCTCTCCCAGAACCTGGCGCGACACCGTCTGGCTCGTCTGGTTCTGCATCCAGATCCCTGTCATCTTGTGTGC
GTCTGCTCCTCTCCCGTCTTCTCCCCCTATCCCTCCAGCTAACCTCCCAGGCGTCGACATCGTCGACAAGTATCCGGCCT
GGCTGTGTGCCAACCCCGGAGCCCCCTTGCATGCCCTGCATCGCTTCCGCCAGTGGTACATTGCCACACACAACGACCCG
GTCGTCCAGTGGACCCCGGCAACACATCCGCTGCTCTCCAACGGCGGCGGCAGCTGGGTCCCGCTCTTCTTCTGGATCGA
GTTGGTCTTCACCCTGCCCACCGTCCTATACGCCGTCTACCGTCTGGGCTTTGTCCGCGGCCGCAACCGGGCTCCTCTTG
GCGGCACCACTGGCCCGCTCGAGCTGCTGCTACTCGTCTACGCACTCGAGACTGCCCTGACGACCGCTGTCTGCATCCAC
AACATCAGCTATTGGGACCCCTCCATCTATTCTTCTGCCCAGAAGAACACCTTCCGCTTTCAGCTGATGGGCCCGTGGCT
GGCCATGCGTGCGTTATCCTCTCTCACCCGTCACTGCTGACTGCTTACTTAATACTGACTAAGCAGCCTCTCTCCTCTTT
CTCGACATGTACTCCCGTCTGCTGGCCCGTTTCTCGCTCGCCGTCAACACGGACAAAAAGACGCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62