GenePrediction:GLEAN_7939 Details

Name: GLEAN_7939
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2107696..2106754 (- strand)
Length: 943
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2107696..2106878 (- strand)
Length: 819
Type: CDS
Source: GLEAN
Position: GCSC_113:2106819..2106754 (- strand)
Length: 66
>GLEAN_7939 class=GenePrediction position=GCSC_113:2107696..2106754 (- strand)
ATGAACAAGTGGCTCACTGCCGTCAAATGGAGCCCGAGGGACGGACGCTCAGATAATTATCATCGAGCTAAGACGCATGA
AGTGTTGCACGAAATTCTGCTTAGTGAGAGTATCGATGCTGCTGTCCCTGAAGGAGACGAAGAGGAAAGAGGATTCCAAA
AATGGCTCATCGAGGGAGATGGTTCGCTGCGTAGTGGTGAAGGCGACGGCTACTGTGTGTTCTCCATAAAACCGAGCTTG
TGGACATTAACTGACGGGATGCTCAAAGTGGGAGTCGAATCGATATCGCCAATCCTCTTTCCCAAAAAGGATTGGCGATA
TGACCTTTGCCATCTCTACGAGATTATAAGTAGCAAATTTGAGATAAAGGTCGGCGCGTGCTGTGGCACACACGTGCACA
TATCTCCGGATACGACTCCTGGTCGCAGGTGGACCCTAGACGAGCTCAAGTCCATTGTGAAAACTATTGCTTATTTCAAT
GTCGGCGTGGTGGACATGCTGCCACCAGAGAGGAAACAGAACCGGTACGCGGTGCCGAACTTTTGTCACAGAGATTCCCC
GCACAACGTTCGGGGGCTGCACGCAACGGCGTGCAGCACAGGGGACTACGGTCCTCTGTTCTCTCATATTGACCAGGTGG
TGAGTCCGGGGGCCTTTGCCCATTATTTTCCGAACCGCTGGTGGGAATTCAACTTCAGCAACATCACCGACGACAGTAGT
TCCTGCGGAACGATCGAGTTCCGAAGCGCGCCTGGATCGGAGAAAGTAGACACGGCTATTCATTGGGCCCTTTGGCTCAT
GTCGTTCGCTGCATCAGCGGTCCGTACGAACTGGTCAGCGAAGAGCCAAGCAGCTCGCGGACAAACTTCGGTTCCAGCCC
TTCGACAATTTCTCATGCAAGGGCAAGCCCGGCTTCCTTCCCATTCTCGTGAAGGAGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62