GenePrediction:GLEAN_793 Details

Name: GLEAN_793
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2167025..2167990 (+ strand)
Length: 966
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2167025..2167528 (+ strand)
Length: 504
Type: CDS
Source: GLEAN
Position: GCSC_97:2167586..2167990 (+ strand)
Length: 405
>GLEAN_793 class=GenePrediction position=GCSC_97:2167025..2167990 (+ strand)
ATGGCGTCTCTAAACATTACCATAGATGACATCCCAAACTTGAAGGGCAAACGCGTCATCATTACAGGCGCCTCATCAGG
CATCGGCCTCAGCGCCGCACACATATTCGCCAAGAAAGGTGCTTATGTGCTCAACCTAGACCTCAACCCGCCACCTGGTG
AACAGCCGCAGGGCGTCGAATTTAGGCAATGCGACATCTCTAAGTGGGCCAGTCTCGTGGATGCCTTCCAGCATGCTGGT
ACCGTTGACATTGCTGTCTCCAACGCTGGGATATCCGAAGAGACGGATTACTTTGCCGACACCTTTGACGAAACGACCGG
AGATCTGCTTGAGCCCAAATATGCCGTCATGAACGTGAATATGCGCGCCGTCGCCAACTTGACCAAGCTGGCCATCAGCC
ATTTCCGGCGACGGGGCTGTCCCGGTAGCATCGTGATTACATCCAGCGCGACGGCCTATTCTCCAGAGCAGTCCCTCCCC
ATATACAGTGCATGCAAAGTAGCTGTAAGGAACATATTGCAGGAAAAGCCACATCATTCGCACAGCTAACACCTCGGTCA
GCTTATCGGTATGATGCGCTCTCTGCGCTCCTCCCTTCGGGCCGAGGATATCACAATCAACTGTGTCGCCCCGGCGGCCA
CAATCACCAGCCTGCTCCCACAACATCTAGCAGACCCCATTATTGCTGCTGGCTTGCCCGTGAGCTCAGCTGAGTTTGTC
GGACTGGCCGTTGTCTACTCTGCCGTAGCAACCCAGCCGCAGATTGTCGAGCTGTACGGCAAGGATAACATTAACCTCTC
AAAGAAACCGTCGCGGTGGAATGGGAGGACGATATTGACGTTGGGCGACAAGTATACCGAGCTAGAAGGCCCGATAGCAT
CTCTGAGGGCAAAGTGGTTCGGCCCGGACAACATGGATCTTACCCGGAACCAACAGGCAGCTACTGATTTCAGAATTGGC
ATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62