GenePrediction:GLEAN_7940 Details

Name: GLEAN_7940
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2105345..2104247 (- strand)
Length: 1099
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2105345..2105324 (- strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_113:2105106..2104938 (- strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_113:2104877..2104247 (- strand)
Length: 631
>GLEAN_7940 class=GenePrediction position=GCSC_113:2105345..2104247 (- strand)
ATGGCTGCTTCACCTCGTCCGGGTCAAAAGACCGCCCTGATCACTGGGTAAACACGAAGAAAGCAGCCTCTGGGGCGAAT
GCATGTGATGCTAATCTGGGGGCAGATGCACACCTGGGGGTATTGGCCATGCGGTGGCCGAGGAGTTCCATGCAAAAGGT
TAACCGCGTGATTCCAATATCGCAGTCTGTATTCCAGATGGTGCCGTATTTGTTGGAAGCTAACGTGTATCATTATCAGG
CCTCTTTGTCATTGCCTCCGCCCGCAGACTGGAAGTGCTGGAAGGCTTGGCGGCCAAGGGCATTGCCACCGTGGAACTCG
ATGTGACGAACAAAGAGTCTATCGTTAGGTGTCGAGAAGAGGTGTCCAAGATCACCTCCGGCCGGCTGGATATCCTGGTC
AACAACGCGTGTGTTGCCGGTCTCTTTCTCGATGATCTCATCCAAATGCTTGCTGACTGACTATATAGAGGCCGCACACA
CGTCGAAGCTGCCACAGACCTAGACATGGATGAGGTCCGGGCCACGTTTGAGACGAATGTGTTTAGCGTCATGGCCATGT
GCCAGGCCTTTGTGCAGCTGCTGATCGAGGCGCGCGGCCTGATCATCAATATCGCGTCGATCGCATCCATTGCGCCGTAT
GCTTTCGCCTCGGCCTACTCGGCCTCCAAGGGCGCCGTCATCGCGTACTCACGCACGCTGCGGCTAGAACTGCGGCCCTT
TGGCGTCCGCGTGACCGTCGGCATGATCGGCACGGTGCGCTCCAACATTGCCAGCAAGCCGCGCTCACTGCCAGCCGACA
GCCTCTACCTGCCCATCGCCGACGTCTTCGAGCAGCGGCAGACCTTCAGCCAGACGAACAAGACCATGGAAACATCCGAG
TTTGCGCGCCACCTGGTAGCTGCTGCCCTGCGGCCAGAAGCACCGCTGTTCCTGCGCAGCTGGTTCGGCCGGCCCGATTG
GTTCTGGTGTGGTGGCATGGCCACTGTTGCATGGCTTGGCACCGTCCTGGGCGAATGGGTGGTCGATGCGTCGTGTTGGA
GGCTGTTTCGCCTGTGGAAGCTCAAAGAGATTGTAGACCAGAAGCTGAAGAAAGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62