GenePrediction:GLEAN_7941 Details

Name: GLEAN_7941
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2102520..2100761 (- strand)
Length: 1760
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2102520..2102488 (- strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_113:2102312..2102211 (- strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_113:2101840..2100860 (- strand)
Length: 981
Type: CDS
Source: GLEAN
Position: GCSC_113:2100793..2100761 (- strand)
Length: 33
>GLEAN_7941 class=GenePrediction position=GCSC_113:2102520..2100761 (- strand)
ATGAAGAGCAAATGCCAGACTCAATCGATCTCGGTAAGCTATATGCCCCATGACCCTGCACTTCGCCCGGAGCTCATAAA
CATGTCTTGAAATATGCGGTTAGTGTGGAGAGACCTCTGCAACAAAGTTCCCGAGGGCATTTGCCAATCTCCGTGCCTGT
TTAAACTCGCATTATCGACACTAGCTATACTAATAATTTTTAATTCAGAATAGGAGTGCGGTTCACGTTGAAGACACCGA
GAAGGAGCCTGCATTAACTCCCACTGCTCCGGGCTCGCACTACTACTGCCCAGAGAAGGATGGTCCCGATGTAAATTTGG
CGAACAGAACAGAATAGATCATTGCACATAAGCTTTAGTGTGGACCCGTCCTTCGATATCTATGGCTTCGCCAGATGACT
GGAGAAGTAGGCTGGCAGCCACAGACCGTTACAACAATGTCCAAAAAATGTGAAACAACCCAGACACCCCTCCGCCATCT
CGTCGAGGCGTCCGAACCAGCGGGTGGAAACAGATTGCTAATGTCTTTGATGTGTGCACAGCGAGGCAGCAGGACAGCAC
ACAACTTTGACTGCAAGTGCATTTATGCTCGAGAATGACGCATACATTTCATCCTCGTCCAAAGTGAGACATCTGAGTGT
CATCTGCTCTCCCGATCTCTCTCGACTGACTCGTGCGAAGGAAGACTATGAAACCGCCTGCGAGCTTCTCTCGGAGCCGC
CGGCAGCAGCAGGAAAGAACGTGCATGGCGCTATAATGGAGGCGAACCTGGGGGACACTATGAACCACGACGACGAAAAT
GATCTGCAGATCGGGTCTTACACGCAGTGCTGCTACATCTCGAGTGGCGTCACGGCCGATGTGTTTCGCAGCGGCACCCG
GGCGCTCAAGGTGATCACCGAGACTAGAGACATGCAGCCGCACGACCATGTGCGGGAGGCCAAGATCCTTGGCCTCGTTT
GCCGGCAGTGCATCCCGCTTCTCGAGACGTTCCACGACCAGGAGCAGCGCTTCGTGCTCGTCTTTCCCTACATGCCACTG
AGCCTCGACGCTGTTCTCGCTCGGACGGACGAGCTGCTGTCTCTGCAACGGCTGTGCAGCTACTTTGTCGACATCTTCGG
CGCCCTGGCCCACATTCATGGCCTGGGCATTATCCATCGCGACGTGAAGCCGTCGGCCTTTATGATGGCATCGCCAGACG
GGCCCGTCCTGCTGTCAGACTTTGGCACCGCTTGGCATCCGGCGCTGTCCCAGGCAGTCGAGCCGGCCGATGGCAAGGTT
CTCGACATTGGCACCGGCCCGTATCGGGCGCCTGAGGCGCTGTTTGGAAATCAGGCATATGGCCCGTCCGTCGACATGTG
GGCGGCCGGTGCAATGTTGGCAGAGAGCGCTCGCCGTCCGCCATCTACCCTCTTCACGTCGCGACCGGCCCATGAGGACG
GCAGCCAGCTGGGCCTCATTCTCAGCATCTTCAAGACCATCGGAACACCCACAGCCGAGACGTGGCCAGAGGCTGCTTCG
TTTAAGACACCCCCTTTTGAAATGTACCGCGTATTTGAGCCGCCGTCGTGGGAGGACATTTTGCCCGAGGTGAACCCGCA
TATTCGTGCGCTTGTAGCAAGGCTCATCAAGTACGACAGCACGAGAGCGACGGCTGAACAGGTGCGTCGGTCCCCCAAAG
CAGAGTGAACGGGATTTTGCGTGATGACAGTACTGACAGACACACAGGCCCTCGTTGATATTCTAAAACTGGCTACTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62