GenePrediction:GLEAN_7943 Details

Name: GLEAN_7943
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2089106..2087418 (- strand)
Length: 1689
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2089106..2088826 (- strand)
Length: 281
Type: CDS
Source: GLEAN
Position: GCSC_113:2088728..2088587 (- strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_113:2088519..2088488 (- strand)
Length: 32
Type: CDS
Source: GLEAN
Position: GCSC_113:2088428..2088088 (- strand)
Length: 341
Type: CDS
Source: GLEAN
Position: GCSC_113:2088020..2088013 (- strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_113:2087954..2087418 (- strand)
Length: 537
>GLEAN_7943 class=GenePrediction position=GCSC_113:2089106..2087418 (- strand)
ATGACTGCCACATCTCCTATCCGCACGTCAACCTCCGGCGAGGTCGCGCACGCGGACTTGGCTATGACGGCGTCCAACGC
GCAGTCCCATCACTCATCCCACAACCACAAGCACCATTCTGGTGCTAATGCCGCAATTATTGAGTACGGCTATCCCCACG
GCCACCTTGGCCACCTTACCGCCGAGGAGGACAAATCTTTCAAAGAGTTCAAACAGTACCTGATCAAGGAGGGCGTGTAC
AAGCCCGGTCCTCCGCCGTCGCACGACGACGCAACTCTTCTGTGAGTTTTCCCTATCTCTGCCGGTCCGAGTTCTCTTTC
TGAGGGAATGCGGGCTGGGCAGCTCGAACGGTGTGGCTAACGTGCCGGGTCACGCCAGCCGTTTCCTTCGTGCCCGGCGA
TGGGTGGTGCTGGATGGATACAAGCAGTTCAAGGAGACCGAAGATTGGCGGGCAGCCACACAGCTGAACCTGCTGTACGA
CACGATCGACCTCGACGGTTACGAACAGAGCCGACTGCTGGTAAGATGGCAACGAGCGTGCGGCGAGACATAGGGGCGTA
AAAGACATGACTGACGTGTTTCCGAAGTATCCGCAATGGACAGGCCGCCGAGACAAGCGGTAAGCCCTCTCTCCGTTGTG
CTCGCCGTTTCTTCTTTCACTCATGACTCCTCTTTTAGTGGTATCCCGGTCTACCTATTTGAGATCTGTCACCTCGACTC
CAAGACGATTTCCACGTATGAGAAGACGACCAACAACACGTACAGCAAGGCAAAGCCGGACGGGAACACGCCACCGCGGC
TGCTGCGCCTATTTGCGCTTTATGAGAACCTGACACGATTCGCACAGCCGCTGTGCACGCAGATGCCCGACCGTGAACAC
GCCACTATTACGCCCATCACGCTGAGCACCAATATCGTCGACGTTTCGGGCGTGAGTCTGCGCCAGTTCTGGAACCTGAA
GAGCCACATGCAGGCTGCCAGTACACTGGCCACGGCGCACTACCCGGAGACGCTGGATCGTGAGTGCGACCCTTGATGCC
CGTCGTGCTTCTAGAAAGTTGCTGACACGTGCTCTCTGCTTCGTAGGCATTTTTGTAAGTGACGCTATTCGGCCTTTTTT
ACTTCCTGCCTGTCTGCTGACAACGGCTGCAGATCATCGGCGCGCCGGTGTTTTTTACCACCGTCTGGGGCTGGGTCAAG
CGTTGGTTTGACCCGGTGACCGTGTCCAAGATCTTCATTCTCGGCCCTCAAGAAGTGCTGCCCACGCTGCTGTCGTTTAT
TGCCAAGAAGGACATACCGAAGAAGTACGGTGGCGAGCTGGACTTTACGTGGGGCCAGATGCCCAACCTCGACCCTGCTA
TCCGCGCGCGCACAACGTGGGAGAATGACTTTACGGACTTTCCCAAGGGCCCGCTGTTCTGGCGGCCCATCGACGGTGGC
CGGGTGGAGTGCGTGGCTGCCGGCAGCGTGAAAAAGGTCGAGCGAATGGCGCGCGTCTGCACGATGCCAACGTGCTTCAA
GGGAGCTGCAGCCGTGGTTCCCGAAGAAGTGACTGGGGCCATTAAACCCGTGGTGGCATCGTCCTCGAACGGACACGTCG
ACGCCGTGGACGCCGAAACTGTGGCCAAGCTCGAGGGGCTCACGGTCACTGAGAAGGCTGACGCAACACCCGCAACAGTT
ACCGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62