GenePrediction:GLEAN_7944 Details

Name: GLEAN_7944
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2085454..2084222 (- strand)
Length: 1233
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2085454..2085023 (- strand)
Length: 432
Type: CDS
Source: GLEAN
Position: GCSC_113:2084939..2084690 (- strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_113:2084618..2084471 (- strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_113:2084417..2084308 (- strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_113:2084253..2084222 (- strand)
Length: 32
>GLEAN_7944 class=GenePrediction position=GCSC_113:2085454..2084222 (- strand)
ATGACGGTCAATGCATTGCGCAAAATCCAACTCACCCACCTCGCCTATGTTTACTACAGGCACAAGGACGCAGTCACCGC
TCGAAAATTCATCGAGGACTTTGGCTTCTTCGAGGAGAAGCAGGCTGGAAAGCGCACCTACTACCGTGGCTACGGAACCG
AGCCCTTTGTTGTGTGCATAGAGGAGGCCGACGAAGCTTGCTGGGGTGGCGCTGCATTTGCAGTAGCGACTGCCGAAGAT
CTCGAGTATGCGGCCGCCACACTGCCGGCTAAGTGCCGGCCCACGGCCGTATACGAATTGACCGACGCACCTGGTGGCGG
CCGTGGCGTCACTTTCTACGACCCCATTGATGGCTTCCCCTTCCACCTGGTGTACGGCCAGCAGAGAGTGGAGGCGCGTG
ATCCCATGTTCCCAGTGATCAAAGTTAATTATGTGTGTGAAGCAAGCCCTCTCCATGCTACGCTCCCTCTCTCAGCTGTC
GATGCAATTGCGTGCTTACTGCATTGGTATAATAGCCTGTTGAGAAGAATCGACCAGTGAACCGATTCCAGCGTTTTGAG
AAGCGCCCGGCACCTGTACACAAATTGGGCCACTTTGGTATGTGCGTGACCGACTTCGTGCGCTGCTACGACTTCTATTC
GACACACTTCAACTTCTTTCCCAGCGAGCTGGTACACGACAGTGCTGGTGTCAACAAGACGGTCTTTTTTCGGCTCGACC
GTGGCGAGCAGCAAGTGGACCACCACGTCTTTTTCCTATACGAAGGTGGGCTTGCAAACGTCGAGAATAGAATCACAAAG
ACACAGATCGAAGTCTACTAACAATCCCGACGTTAGGTCCCAAGTGCCACGTGCACCATACATCCTACGAGACACATGAC
TTCGACACGCAGATACTTGGCCATGACTGGTTGCGGGACAAGGGCTACAGGAACTGCTGGGGCGTGGGCCGTCACGTCAT
GGGTAGTCAGATTTTTGACTACTGGTTTGTGCCATAAATCTGCGTACTAGCTGCATACTGCTGACGTTCATTTGCAGGTT
CGACCCGTCTGGTTTTATCTTGGAGCACTATGTTGACGGTGACCTGCTCAACATGAGCGAGCCGACGCACCACACGCTAG
AAAAAGACGCCCATCTGCACGTCTGGGGTAAGACACCTTTTCCTGTCAATCGGTTCAAGGTGCTAATCCGGCTTTCTCTA
GGCCCCGAGGTCCCATCGACATTTATGGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62