GenePrediction:GLEAN_7946 Details

Name: GLEAN_7946
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2078430..2077839 (- strand)
Length: 592
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2078430..2078376 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_113:2078317..2077839 (- strand)
Length: 479
>GLEAN_7946 class=GenePrediction position=GCSC_113:2078430..2077839 (- strand)
ATGCGGCTCACAGGCACCGAGTCGACTGGCTGGGAGCAGACATTAGATGAATACAGTGCGTATGACTATCAGCCGTCTTT
TGATATCTAGGCCGCACATTAATTTGCTTTTAGTCAAGGCACTACAGCATCATGACTACATGGAAAAGCGCAGCACATCG
GCCCGCGACCCCTTCTTGGCCACGGGAGAATATGCCATTGACAACTATGTGCTAAAGAGCTACATCGGTGATAAGTTTGA
TAAATACCCTAAACTTGAGACCAGTGTCTCGCTTAGGGCCTGGGAAGACGTCAAGTCAAAGGGTTGTGAGTCCATCTGCG
GCACTCGCTACGATAACATACAGAAAACCTGGTGGAGCAAGTTCAAAGAGCGCATCATCCTCGCGGCTGTTGGAGGCGCC
TTTCTCATCGGACCAATGTGGATAATGGTGTTGTTGAGCGGGCCCTTCAGCTCGCTCATTTGTACGACCGCTTGTGTGGC
AGGCTTTGGTATCTTGATATCCTACTACCTTGAAGACGGAAAGGACGTTCTGGGCAGTACTGCAGCATATGCAGCTGTTC
TTATAGTGTTTGTAGGGACAAGTTCTTCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62