GenePrediction:GLEAN_7947 Details

Name: GLEAN_7947
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2076446..2073771 (- strand)
Length: 2676
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2076446..2076094 (- strand)
Length: 353
Type: CDS
Source: GLEAN
Position: GCSC_113:2076015..2075150 (- strand)
Length: 866
Type: CDS
Source: GLEAN
Position: GCSC_113:2075043..2074121 (- strand)
Length: 923
Type: CDS
Source: GLEAN
Position: GCSC_113:2074070..2073771 (- strand)
Length: 300
>GLEAN_7947 class=GenePrediction position=GCSC_113:2076446..2073771 (- strand)
ATGAAGCTCTCTTCTCCTATCTCGGCAGGCGCTCTTGCCAGCTGCGCACTGGTGCTGGGGCTCTTTGCACAGGATGTGGT
GGCGCTACCGTCGCCCAAGTCGTCGTGGGTGCGCAAGGGCCGCAGTCGTAAGGCCATGGCCGACATTCTCAACGGCAAGA
CCAAGGGGAAGCGGTCCGGACTGTGGCAGGACGCCTGTGCCAACTCGACGGCCAGTGTCGTGACGGCACCCAAGGCCAAC
GTTTGGAGCAGCCTGACGGACGTGGAGGCGTCGTCGGTGGTGGCCTGGCTGTTTGCGCAGCCGGAGCTGAATCTGACCGT
TGCTGAGAACGCGACAGAATGGGACAACACGCTGTGAGTGGGGGAATGCTGGGTTTTAGACACGCCGGTGTTGATTCTTG
GGGTGGAAAGTGGTATTTGCTGACTAAGCAGTCTTCTGGTCGAGCTCATGCCGCCAAACAAGACGGACGCGGTAGCCTAC
CTGGACGGCAACGCGACAGCACCGGTGCGGTACGTGCACGCGGTGCTGGATAACCGGGCTTCGGAGTCGGCGACGTACCA
GGACATCCTGGTGGGTCCGCTGCCACTGGACAACGCGACGGCCTCGTGGGAGCCGCTGACGTACGTCTACAACAAGGAGG
GCGGCGATGGCAAGGTGCGAAACCTGGACGCGGACGACGACACGACCGACTCGGCATGGCTGTACCCGATTGGGGCGTCG
ATTGCGGACATCACCCTGGACCTGTGGAACGCAACGGCAATGGGCCTGGACAACGATACGTTGGATATCTGGGGCATCGA
TCCGCTCTGGCAAGATGACGGCCGGGTGACGCGCTGGGACACCTTCTGGATGGACACGACGGACGAGTTCGACTCCGGCA
CGTTGCTGCCGCTGGGCCTGTACTTCAAGTCGGACGTGACTGGCCGTGACCCGAGCCAGTGGAAGCTCGAGGGTTGGCTC
TACAACGACATATTCTACCCGACCACGGAGGCCTTCCGGGCTGCCTACTGGAGCGAGGGCTTCGTCAAGCTGGGGGCCAA
CGTCGAGGGTGCCTGGGGCCACACCGACCAGACCGGCCCGGTCCGGCCGCTGGACACGCTCTACCCGCCGACCACTATTG
CCCCGGCTGGCAGCCGGTTCTCCGTCGACGAGGAGGAGAAGTACGTCGAGTGGATGGGATTCAGCTTCTACATCTCGTTC
CGGCGCGACACCGGCATGGCCCTGCACGACATCCGGTACAACGGCGAGCGGATTCTGTTTGAGCTGGGCCTGCAGGAGGC
CCTGGCACATTATGCAGGTGGGTTGCTTTTCTTTCTTTTTCTTTTTCTTTTTCTTTTTCTTTTTCTTTTTCTCTTCTCTA
CCTTTGTTCTCTACTCCTTCTATCCTAATACTGAATCTCCCAGGAAATGATCCTGTCCAGTCTGGTACGGCCTACCTCGA
CTCGTACTATGGCTTCGGCCCCTACGCCTTTGAGCTCGTGCCCGGATACGACTGTCCAGCCTACTCGACCTTTCTCAACA
GCAGCTTCTATGTGTCGGAAACGACGCACACGCATGTCAACTCGATCTGCCTGTTCGAGTACGACGCCGACTTCCCGATC
CAACGGCACAGCACGAGCGAGTACGTGTCAGTGACCAAGAACACGTACTTTGCCGTGCGCTCCGTCTCGACCGTCGGCAA
CTACGACTATGCCTTTACCTACAGCTTCTTCCGCGACGGCTCCATCGCCGTCGAGGTTCGCGCCTCGGGCTACATCCAGG
CGGCCTACTGGGCCCACAACCAGGACTACGGCTTCCGCATCCATGATGCTCTCAGCGGCAGCATGCACGACCACGTCCTC
AACTTCAAGGCCGACTTTGATATTCTCGGCACGGCCAACTCGATCCAGCTGGTCAACCAAGTCCCCGTCACCAAGTTTTA
TCCCTGGAGCGGCGGCAAGCCGCGCAACACCATGACACTCGAGCGCTCCTTTGTCCAGTCCGAAGACGAGGGCCGGTTCA
ACTGGGCCGACAACAACGCTGCCCAGGTCCTTGTCGTCAACCAGAACGTCACCAACGACTTTGGCGAGTACCGTGGCTAC
CGCATTCTGCCCTACACAGGCACTGCCCACCTGACCGTCACCGACTCCAGCAACCTCGTCAACGCCGCCCACTGGGCCGA
GTTCGACGTCCAGGTCACCCGCCAGAAGGACACTGAGCCGCGCTCTGCTTACGCCTACAACACTCAGGACGTCAACGACC
CTCCCCTCAACTTTGCAAAGTTCTTTGACGGCGAGAGCCTTCTGCAGGAGGACCTCGTCGTATGGCTCAACCTGGGCATG
CACCATGTACGCTTCCTACTCTCCCTCTTTCTCTCGTCCCATTCGCTGACTTTCAGATCCCCCATACCGGCGACCTGCCG
AACACTGTCACCACGACGGCCCACAGCGGTATCCAGTTTATGCCCAGCAACTACTTCAGCCTTGATGCCAGCCGCGAATC
TGTCAGCCAGGTGCGCATTAACTACGACAGTGGAAAGGTGACCTCTGTGAACACCTTTGGACAGAAGGACAATAACTGCT
CGCTCGACTTTGAGCCTGTTGAGCCCGATTTGTATTCCTACACCGGCGACGTAGTGATCCGAAAGTTCCCTTTCGATCCC
AATCAGCCGTACTATGAGACCGACAGCATCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62