GenePrediction:GLEAN_794 Details

Name: GLEAN_794
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2188284..2189729 (+ strand)
Length: 1446
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2188284..2189158 (+ strand)
Length: 875
Type: CDS
Source: GLEAN
Position: GCSC_97:2189402..2189729 (+ strand)
Length: 328
>GLEAN_794 class=GenePrediction position=GCSC_97:2188284..2189729 (+ strand)
ATGCCCGGCAATTCCGTGATCCGTTCCACCTTTATCGGCGAGGCGTATCCACCATATACTCTGCCTCTTGCAAGCCTTAC
ACCTATTCGCCTCCGCGACCTCACCCTCGAGACGCAGCATCGCGGGCGCGTTCTCATCGTTAGAGCTTTTGGCAAACCCA
ATGTTTATACGTCTATCATAAACGCCGTCGAGGACGAATTCGGCGACGTGGACCGGCTCGCCATCTACAATCTGCTCTCA
ACTGTTGCACCAGATGACGTCCTCCCCCAAGGCGCGATTGCGGCCATCAAGGAGCCGTACTACAAGCGCACCGCTGATGG
AGACTTGTTTGTGCGCGTGGACCACCCGTCTGACTTCGTGCTGCTGAAACTGGAGAGCCAGCTCGTTCCCCCGGAACTAG
CCCCACGGGTAACCGAGCTAGATCTGTCAGCGCTAAAACTGAAAGAGCGCGGCAATGCGGAATTTAAAAGAGGCAATTGG
CAAAAGGCCGACGAGTTATACTCTAACGCCCTGGCAGCCGCCGATCTTGTCGCCGCCGATGACGACGATCTTGTTCGAGC
TTTACATCGAAACCGTGCCGCAACTCGCCTGCGTTTGGGTCGTTACGAACTGACTATTGTGGATGCTTTGGCTAGTATTG
TGGTGGCTAGGGCAGAGACGAGTTCCGAGGCGGTAAAAGATTTTAACATAAAGGCCCTCTATCGAGCAGGCAGAGCGACG
TATAAGATGGGAAGCTTTTTCAAGGCGAAGAACCACTTTAAGGCGGCACTTAAGATTGATACACAGCGTAAGGAGGTTAA
GGTAGACCTTTGCCTAACTAAGAGACGCCTTGCGGAACAGGAGAACGGAGACTATGACTTTTCTGCTATAGCCGCGTTAG
TCTCTAAGCAACACAACCTGCTTAATCATGCCTCTTTCCTAAAAAATACACAAGTTTCCCCAGCAAATAGCCGCGGCCGT
AGCCTCTTCGCCACAAAAGCACTTAAGCCAGGCAACGTAGTCTTTGTCGAGAAGGCCTTACACGTAGCACATTTAGTAGG
CGATAGGGACATTGCGCTCCTCCTTAACATTAACAATAATCGTGCAGCGATTAGCACACATGCCTTGCGTCTCTATAGTG
TAGTCAACAAGCTGCTCTGGAACCCTACGCTTGCCAATCGGTATCTTAACCTACACGACAGTAGCACGTTTGGCAATAGC
AAGAAAATCACAATCGTCGATAGCAAGGTTGCGCTGGACACATTCCGCGTGGAGTCTATCGCCGAGCTTAATAGATTCGG
CTGCCCAAGGGTGAAATCTGGTGACAATGAGGGGACCACCGAGGGAGAGGAGACTAGCACGGGTATCTGGTTGCAAGCAT
CCTACGCAAACCACTTGTGTATCCTAAATGTGTCGCGCGCTTTTATCGGCGATATTATAGTCGTCCGCGCTCTGCAAAAT
GTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62