GenePrediction:GLEAN_7950 Details

Name: GLEAN_7950
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2062203..2060011 (- strand)
Length: 2193
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2062203..2061424 (- strand)
Length: 780
Type: CDS
Source: GLEAN
Position: GCSC_113:2061359..2060925 (- strand)
Length: 435
Type: CDS
Source: GLEAN
Position: GCSC_113:2060853..2060011 (- strand)
Length: 843
>GLEAN_7950 class=GenePrediction position=GCSC_113:2062203..2060011 (- strand)
ATGTCGAGGCAACCGGCCTCTTCACCGAGATCGACACCACCGCCGGGCTGTGCAGAGCCGCCGAGCGGGTCACGCGAGTC
CGTGTCCTACGGCCGGCGGCGGGCTGTCACTGCCTGCGTTATTTGCCGTGCGCGCAAGACTAAATGTGACAACCGGCGGC
CGGTGTGCGGCTTCTGCAGTGCCACCGGCGGTGCCTGCAGCTATCCGGACGACACCGCTGCCGACCACTCAAAGCTCGAC
CGTGGCAGCCTGGCCATCCTGCAGCGTCTGGGCGAGATGGAGCAGACCCTGGCCGCGCTGATTGGCGACCGTCCGCTGGG
TCGTCTGAGCGCCGCCGACAGCACGGCGCCGGGCTCGACGCCGGGCTCACGCCCCGGCTTCTTCGACGACGGCCTGATGG
CTTTTGACGATCCCATCACGACCACCACCGCGCCCGACAACAACAGTCAGCCGCCGCCCAGCAGCGATCGCCCGCCAGCG
GCCGACGTCGTCACCCGCAGCTCTGAGATGCGCGTCGAGAACATCCTCCAATGGCCCGTCTTCCACACCCAGGCATATCC
GTCCCTCACCGCCACCCTCGGCCAGGACGGCGCTCACATGCCCTTCTCGGCCGGCGACGGTGTCAGCGACCTCGACGCCG
ACCTCATCACCCAGCTGGTCGAGAACTTTCTCGCCACCAACCACATGAAGAACCCCGTCTTCGTCGTCGACCAGCTCTGG
GCCCGCGTTCGCGACATTGCCGAGACTGGTCTCCGCTGGGACGGCTCGACCTGTCTGGTAGTGCGTGTCTGTCTTGTTCC
TCGCTTCGCTCGCCTAGTCTGCTCCACAGCTAACACAACTCCAGCTTCTGATCTGCGCCGTCAGCGTCGTCTCTCCTCCC
TTTTCGGCCGAGATGCAGCCTGGTTACTCTCATCGCATCGACCGGCTCCAGCGAGCCGAGCACTACTTCCAGATGGCCCA
GCGACGCATCGGCATGCTCTACCACACCAGCTCCCTGCTCGCCGCCCAGTGCAGCTTCCTCACCGCCATCTATCTCATGG
CCACCTTCCGCATTATGGCCGCCTGGAAGGCCTTTGCCCAAGCCGGCACGCAGTGTGTCGGCTGGCTGGCTACCCGTGGA
CACACGACCGGCCAGTCGGACGCCCAGGCTGCCGCCTCATTTCAATCCCCCCCCACAAATGGCGGCATCCACACCGTCGG
CGAAGATACCTCCCGCAGCGATGGCGAGCAGCACATGGAGGAGAGCCTCTACTGGAGCTGCCTCAAGAGCGAACTGCACG
TGCTTCCCCACGTGCCCCACTTCTCCCACCCATCTGCGAGTGCTGACTAATCAGTGAACTTCGCACGGAGCTGGGCCTTC
CGGGATCGACGCTCAACGAGATGCAGTACTCGCACGCATACCCGTCACCGCCGAGCCCGGAGCATCTGGTGTCGCGCTAC
GGCCAGGGACAGCATGAGCGGGACCGCCTGGAGCGCAGCTGGTTTTTCTACCTGGCCGAGATTGCGCTGCGGCGCATTAT
GAACGACGTGCTGTCGTCGCGTTACGGCGCCGGATCGTGGTACTACACGGCACCCTGGTGGACAGCCGAGGGCGAGGGCT
GGCTGCGCGGTGACGTTGACCGGTTCCGCCAGCAGTTGGGTACCTGGGAGGCCATGCTGCCGACCGCCATGCGCTTCCCG
GCCGACGAAGGCGCCGGTGGCGTCACGCCGGCTGAGCCGACCGGTGACGCCTTGCGCGGCATTTTGCGCGGCCACCTCGT
TGACATCCTCGACGTGCTCTATTTCCCGGCTGTGCGCGCCGTCGTCTGCTGCCATCGCCGCGACGATCTCGGCCCTTACG
TGCTCGCGACCGCCCGCGATGGCCTCGCCAATGCCGCCTACCGCATCGCCATCTGTGAGGAGGGCTTCTGGCACCGCCAC
CAGGGCACCTGGCTGATGATCCGCACTTGCTCGCGAAGCCTGCTGCAGCTGCTCGCCGTTGCCCTGCGCGCCCGCGACGA
GCCGGCCCTGGCCGCCCTCCTGCCCGACGGCTGGCGCTACTCTGCCGCTCGCGTCCTCGCTCTCGTCGAATATTGGCAGC
ATGAGAGCGCCGACCTCCGGCTGTTGCTGGTTCGCCTGCAAGCCATTATCGCTGACCTCGACAGCACCAGTGGATCGGTC
GGTGGGAGACTGGCGGCAGGAGATGTCGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62