GenePrediction:GLEAN_7951 Details

Name: GLEAN_7951
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2053335..2052103 (- strand)
Length: 1233
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2053335..2053213 (- strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_113:2053148..2053099 (- strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_113:2053044..2052913 (- strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_113:2052637..2052103 (- strand)
Length: 535
>GLEAN_7951 class=GenePrediction position=GCSC_113:2053335..2052103 (- strand)
ATGTCCAAGAGCACGAGCAATGGGCCGGCACCGCCAGAAGCCATCTCCCATGTTGCGTCTACTACCATACCACCGACGTT
TGACGAGCCCATACTGGCGGCCGAGGTTCCTGACGGAGGCGATGTAAGTCTTGATAGGATAGAACAGAACGAGGAGATGG
GTGGACAAAACTGACGTGTACAACCAGGGTGATGACCTAGAGGAAGATAGAGACTCGGCTTACGATGATACGTTCTCGTA
GGTTTTGTAGCCTCGGAATCGTCGAGGAGCAATTTTGACTCGTATCTCTAGGGCTCTGACGGCATCACTCTCAAGCAGCG
TCTTGCAATACCGCAGCTTTCACGGGCGAACGTTCCATAGCGACAAGTACAACGCGTACTTTGTACCAAATGACAATCAA
CAGCAAGAGTCGCTTGACATTTCGTATGACCAGGCCATCCATTCCCTCCGTGTATCTTGCTAACGGCTTTGTCTCTCAGA
CACCACTACCTAACACTTCTGTTAGATGGCGCCCTCTTCTTGGCGCCCGTTCCGGAAACGGTCAATGTCAGTTTTCTTGA
TGGTCAAGCTGAATACGAATCCGTGCAAACGAACGTGTCCTGTAGAAAGTACTTGATGTTGGCACTGGCACTGGCATTTG
GGCGATGTATGGATATCCGCGCTATATTTGTTTGCACGATACTGATTTTTACGTCCAGCGACTTTGGCGACAAGTTCCCA
AATGCCCAAGTCATCGGGACCGACATCTCGCCGATCCAATCGATCTGGGTGCCGCCGAACACCAAGTTCGAGATGGAAGA
TGCCACACAGTCGTGGACATGGCCCGACAACGAGTTTGACTTTATCCACATGCGCTATTTGGTAGGTGCGATCAGTGACT
GGAATGCGCTCTTTGCACAGGCATACCGTTGCTGCGCGCCGTCCGGCTGGTTCGAGTCATGCGAGATACACGTCGAGCAT
CTATGCGACGACGGAACGGACCAGAAGGCCCCGGTCCTGAAGCAGTTCTGGCGACTCTACGAAGAGGCTGTTCCTATAAT
TGGACGGTCAATGCGCGTTTCCATAGACGGTACGCAGCGGAAGGCGATGGAGGCTGTTGGCTTTGTCAATATCCAAGAGA
AGGCATTCAAACTGCCTGTTGGCGGCTGGCCAGCTGACAAGAAACTGTCCGAAATTGGCCAGTATAACCAACTAACTCTA
CTGAACGACTTAGAAGGTACGTTCTCAATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62