GenePrediction:GLEAN_7952 Details

Name: GLEAN_7952
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2046555..2045230 (- strand)
Length: 1326
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2046555..2046508 (- strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_113:2046366..2045230 (- strand)
Length: 1137
>GLEAN_7952 class=GenePrediction position=GCSC_113:2046555..2045230 (- strand)
ATGCCAAAGCAAACGGCCACTGCCGTTTCCTGGGATGGCGCGCCTCCAGTATCAGAGAACGGCTTCACTTTCGTCCATGG
CGAGCTCTTCGCTGAGTCTTCTGGCCAGAACCGACACCGGCGAGCGACGGTCGCAGAGCTGAAAGCACATGTCGCCGCTA
GCAGTGACAAGGACAAGCCGGCGCATTAGTTTGAGGCCCAACTAGTCCACTACGGACTGAAGTCGTCCAAGACAAAGGCA
GTAGCTCGGATGCGACTGGTAGATGCTGTCAATGCTGGGAATTTGAGTGTTCCGGAACATGTCTCCAAGTTGGAGGCCAA
GTTGAAGAAAGAATGGACCAAAAATGACAAAGACCTGAAGAAGGTATCCAGCAGCAGTACGGGCTCTGGGTTGATAGAAG
CAAAGAAGGCTACGGCAGCGACAGGGAAGAAGCCAGTCAACAAGCGGAAAGCCGAAGCTACTTTAACGCCAGCGACTTCA
TCGACAGGTACAGCAAAGAGCAACACGAAGAAGGCGAAGACAGCGGCCACTGCTAAGGCTACAACTCGAGAGACAAAACT
CAGAGTGGCAAAGACAGAACCGGAAGGCCCCAAGGTGCAAAAGAAGCAGACCGCTCGTAGGGGTGGCCATTCACAGGGAC
TCGTGCGCGGTGCGTCTACGGCAGTTTCTCAGCCTCAGGAACGACCTGCCCGGACTAAGCAAACCGCGAGACGGAGTTCG
GCCTTCATGGCACGGGGCCGAATACCAGCTCCATCGCCTGCTCAATCCTCCGGCAGACATGACTACGACATGAACAGCGA
AAATCAAGGCTACGACGAAGATGGTTCTCGTGGATATGACGAGGATGAGGACAACTATGACGAGGATGACTCTGATATCG
TTCTTGCCCCTCTCGGTCTCTTAAATGGTAGCTACGAGATTCAAAGCGAGTATGTGGAATCCGAATGGAACGTGGGCTCG
GAATTCTCTCTGGATTTGACACTCGAGGGCTCGAGTCTTTGGGGTTCCTTCGATTTGGGTATCCTCGAAGGGGTAATATT
ATTCGAGGAGCGGCCTTGGCAATCATCCCACGATCCCGTACCAATCATATGGCGTGGCCGCGAGCTTGATGGCCCTATCT
CCTACGGCGACCAAAACGAAGGCTGGATGAAGTTTTATGGCAATGGTCGGGTGGAAGGATGGATTGATTTCTCCTCAATC
ACTTTTCAGGGCGACAGACTCCAGGGCCAAGGCACCCAGGGGACTAAAACCGCCAAGAGTCTGCGTAATGAATGGCTTGG
TTATTCTGAGGACCAATATGAGTATGAGAATAGATCTCGCTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62