GenePrediction:GLEAN_7953 Details

Name: GLEAN_7953
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2039105..2037139 (- strand)
Length: 1967
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2039105..2038894 (- strand)
Length: 212
Type: CDS
Source: GLEAN
Position: GCSC_113:2038836..2038674 (- strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_113:2038611..2038369 (- strand)
Length: 243
Type: CDS
Source: GLEAN
Position: GCSC_113:2038298..2038104 (- strand)
Length: 195
Type: CDS
Source: GLEAN
Position: GCSC_113:2038043..2037667 (- strand)
Length: 377
Type: CDS
Source: GLEAN
Position: GCSC_113:2037619..2037139 (- strand)
Length: 481
>GLEAN_7953 class=GenePrediction position=GCSC_113:2039105..2037139 (- strand)
ATGGCCGCCTCGGGTGTATTGCTGTCTCCAGCCTATCTTGGGGGCATTGCAGTGCTGGCCGTCATTTTGCTGCTGGCGAA
GCTTAGTACAATAGGCCGCCGCCCGCGTGACCTGCCGCCTGGTCCACCGACGCTGCCGCTCATTGGTAATTTGCACCAGA
TGCCAACCAAAGAGGCGCATCTGCAGTTCCAGAAATGGGCCAAGGAATACGGGTAGGTTTTTGGGATTCTCCAAAGTATG
AAGCCTAGATAACTTACTGACTCCGCCAGCCCCGTCTACTCTCTCATTCTTGGTACCAAGCCCATGATTGTACTGTCCTC
CGACGTGGACGTAAAAGATATGCTAGACCGCCGTAGTGGTATCTACTCAGACCGTCCGGATATGTTTATTGCTCAGAAGA
TTGCTAGCGGCAATCTGCGACTGGTTGTGATGGTGAGCTCTGTAAAACAGTAAAACACTATCCCCAATTTTGAAGAGCTG
TATTAACATTTCAGCGTTACGGCGACAACTGGCGCATGATTCATAAGATTGTGCACAACATCTTGAATATCAAGGCCGCA
GTAACTTATGTGCCATACCAGGATCTCGAGAACAAGATCTTCCTTGAGTCTCTACTTGACTCCCCAGACGACCTTTTGCA
TCACATCCGCCGCTTCACCTACTCCCTCTCGACGCAGATGATCTTTGGCTACCGTTGTGTGAACAACCGGGATCCAAATT
TGTTGCAGCTATTCACAGTGTGTTCATGGGTCAAACTATTCCTGATGTCCTTGTGTTATGTTTTGTAGCATCCCGTGCTA
ATAGCAGTGCTTCGAACACTGGGGCAAACTCTCGAACAGCTCGAGCGCGCAAACGGCCGACCTCTTTCCGATTTTGCAGA
GGCTGCCATCCTGGATTGCACCCAACGTCAGTTACGCCAAGAAGTTGCACGCGGTTGAGAAAGAATTGTATGTAAGCCAC
TGGATGCGCTCGAAGATGGCGCTCGAGAACGGGACAGGCTTGGTACGTACAGATCTGTTAAGAGAGAGAGAGAGAGATGT
GCTAATCTGGCTGCACTTATAGCCTTGTTTCTGCAACGACTTCTACCGCGCCCAGACAGTCGAAAAGTTTTCTGATGATG
CTGCTGGATACATGAGTGGCTCCCTGCTCGAAGCTGGCTCCGATACAACTGCGTCAACCTTGTACGGGTTTATCCTGGCG
CTGTTGGTGTGGCCCGAGGTGCAAGCGAAGCTTCATGAGGAAATTGACCGCGTCGTGGGCCCGGACCGGATGCCAACGAT
AGACGACTGCGAAAGCCTGCCTTACGTGCGTTGCTGTATCAAGGAGAGCCTACGTTGGATGCCCACTGTGATCCTGGGCG
TGCCGCATGCGGTGATACGAGAGGACTACTACAAGGGTTGGCGTATCCCGAAGGGGTCGACGGTGATCAACAATGTCTGG
TGAGTTATTCCTTCCAGCGCTAAAAGTCACACTTCTAACTTATCAGGGCTATTCACATGGACCCCGATCGCTGTCCCAAC
CCACGGGTCTTTAATCCCGACCGCTTCAAGGATGACCACACCACGCTTTACCAGTCTGCTGTTGGTGATACGACAAAGCG
CGACAACTTTGTCTTTGGCACTGGTCGTCGTCTGTGCCAGGGCATCCACATTGCCGAGCGGTCACTGTTCCTCGGCATCT
CGCGTCTCGCCTGGTCATTCACTCTCTCACCCGCCAAGGACAGCTTGGGCCAGCCCTGGAAGTACGACACCGAGACATTT
GTTGGTGGAATATCAGTACAGCCACAGGACTACCCGTGCATCATCACACCGCGATCTGCCGAAAAGGCCGAAATCATCCG
TAAGGCTGCGTCGGAGTGCCGCACCTTGCTGGATGATAAGACAGGTCAATGGAAGAAGATACCGGATGGCATGGCATTCA
GCACTTGGGTGCCGGACCATGTCGAGCCCAAGACGGAGTACGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62