GenePrediction:GLEAN_7954 Details

Name: GLEAN_7954
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2036277..2034342 (- strand)
Length: 1936
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2036277..2035640 (- strand)
Length: 638
Type: CDS
Source: GLEAN
Position: GCSC_113:2035566..2034342 (- strand)
Length: 1225
>GLEAN_7954 class=GenePrediction position=GCSC_113:2036277..2034342 (- strand)
ATGGCAAAACAAGGCGAGATTCTGAAAGAACCCCATGTCTTGCCTACAGGAACGGTTCTCATTGCTGGTGGTGGTCCTGT
CGGGTTGATACTGGCACGCGTTCTGTCGTTTTACGGAGTGAAATCGGTGTTGTTCGAACGTAACGCAACGACGACGAGCT
GGCCCAAGATGGACCTGACGAATGCTCGATCTATGGAGCTCTTTCGAAAGATTGGTCTTGCTGACGATCTGCGGAAATTC
GGGGTCCCGGCCAACTTTGACCAGAATGTGCTCATCTCGGCTGGACTGGCTGCTGACACACCTATCACAACATGGAAGCT
ACCAGGCGTGGACAAGTTCCGCGCCCAGATTCGCGAGAAGAATGACGGCAGCCAGCCGCTGGAGCCATGGCAGCGCATAT
CGCAAGCCATCTTTGAGAAGTGGCTCGAGGCGATCTGCGAAAAAGACCCGCTCATCAGTCTTCACTACAGCCACCGAGTT
GACCGGGTGGAAGAAGAAGAGGACCATGCAAAAGCAGTCGTCACGGACAGCAAAATCATGATCAGCACTGTCTGGAAGTC
CGACTACGTCATTGGCTGTGATGGTGCATCTAGCAAGGTTCGGCGTTCTCTCAGCCTGCCACTGGATGGCGGACCTATGT
AAGGTTCTTCAATCGAATGGGAGATGAACAGGGAGTATGTGCCGATTGCTAACGAGCTTCATCTTCTCTAGTCCATCCTG
TGCTCTTCTTGTGCACTTTAAGTCCAGGGATCTCACACGTCTGCACAAGCAAGGTCGTTTTTGGCACATCTTTTTCCTCG
GCCAGTCGGGCGGTTTCGAAGCCGCAATCATATCACAGGACGAAAAGGATACCTGGACGACGCATCTGTTCATGCCCGTG
GACGCTAACCCGGACGAAATTGATTCGCACGAGGCTGTATACCGTATTCTCGGTGGCCTCTACGGCAACTACCACATCAG
GATTGACGAAATCCTGGTCCGCTCAGTGTGGCGACCGAACATTGCGGTCACGCGGAAGTGGGCAGGGCCTCATCAGCGCG
TGTTTCTGGCGGGCGATGCCGCCCACCAGAACATCCCTACAGGTGGCTACGGCATGAACATGGGCATCGGCGATGCCTTT
GACCTTGGTTGGAAGCTTGCGGCCGTCATCCAGAGCCAGGCCGGTCCGACGCTGCTCCGGTCCTACGAGCTGGAGAGGCG
GCCGGTGGCCCTGCGAAATGTGGTGCACTCGGGCGTACACTTCCGCGTGCATGAACATCTCAAGGAGCTACTGCTGGATG
GGGGGGACCCGCGTCGGGTGGTCGAGGACACAGACGAGGGCCGGGCGCTGAGACGCAAGATCCACGAATACTACCAGGAG
CACGACGGCGAGAACAAGGACTTTGGCATCGAGATGGGCTACCGCTATACGTCGCCGGTGATACTGCGGCAGGATGACGA
CCTGGACGAGCCGGTGTGGATGGCTCGCCAGTACGTGCCGACGTCGTGGCCGGGAAGCCGACCGCCGCACATCTTTCTGT
CAGATGGGACGCCCATCTTCGACAAGTTTGGGCCAAACTGGGCCCTTCTCGTGTTTACGGACCAGGACGTCGGACAAAGC
TTCTTGATGGATGCGGCATGCCGACATTCTGTGCCGCTGCTAAATGTGTACCTGGCCGATGAGAAGCTCGCGTGTAGCTT
GTACGAGAAGAAGCTCGTGTTAGTTAGGCCGGACCAACATGTTGCGTGGAGGGCCGATCAGATTGATGCAGACAAGGACG
CCGAACGTATCTTGCAGACGGTGATAGGACGAATTGAGACAACCACCACTCCGACGAATGGGAATGGAAACTTCGAGACT
AGATCGGGGTTTGAGGCTCGACTTACAGACCTCGTAGAGGTCACCACGCAAGTCAATGGTTTCAGTTTAGATAAGCAGGG
CGATTTCCAGCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62