GenePrediction:GLEAN_7955 Details

Name: GLEAN_7955
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2026410..2024109 (- strand)
Length: 2302
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2026410..2025206 (- strand)
Length: 1205
Type: CDS
Source: GLEAN
Position: GCSC_113:2025136..2024673 (- strand)
Length: 464
Type: CDS
Source: GLEAN
Position: GCSC_113:2024599..2024109 (- strand)
Length: 491
>GLEAN_7955 class=GenePrediction position=GCSC_113:2026410..2024109 (- strand)
ATGGTCTGGTTCAGCCAAGTCCAGGCTTTTAGCCTGGCTTTCCTTACACAACAAGTCACGGCCCAGTCTAACCTGTATCC
TGAGGTCGACTCAGAAAGACTGGCAAGTGCCCTCAACATCAGCGGCAGTTGCTTGGAAGCCTTGAACATGACGGTTGACT
GCGACCAGACGCTTCTGTCCATGGCCGGCAGCGTGGACGACTACCTGTGGGACGTCGACAATGTCACGACGCTGTGCACC
AGCGACTGCTTGTCTTCTTCCCAGACTTGGTTTTCCACAGTCTATGACAGCTGCTCTAGCGATGTATTGGTCTTCTTGGG
AAAGCAAGTGCCAGCATACACCATCCCTGGCCGAACGCTGGACGGCCTCAACATTGCCTGTCTGGCGCCAACCACCAACG
TCAGCGCGGATCCCGGCGTTGCAGCCAGCATCGTGACTTACACCAACGTCACTTCAAACGGCACGGATGACTCAGACGAC
TCTTCCTCCTTGGAGACACAACAATCGGCTACAGTGTCTCTGTCTTCGAGTGGGTATTGTTTGATTGACTCCTACAACTG
GGTCGGTTCGGACATCATTCGACCGGACTGTTCTTTGGCTAGCAACGAGAACAACAGTCAATGCATCGATCCCACGGATG
TTTCAGCTGAAAACGAGCGCCTCGCCAACCTGTATTCCAACGACATTTTGTGTGATGCGTGCTTTGTCAACATGTTCTTT
TTGCGCTTGGCATCCTCCTACCTACCGGATACCGACTATTCCGACCACCTAATTCTGCAGTACTACGACATTCTGGAAAC
ATGCAACATCACAGGAATGCCTGAATTGATCATTCGCGAAGATCCAGACTACCTTGATGCTCCGGGATACGTCGATGGTA
TGCTCACCAACACAAGCAGCCTGCAGCCTTTCCCCGATAGTATCTCCATCAACGTACTGCCCAACAGCGCGGCCAGCTTA
AACAGCACATGTGCTGGCCAGAGCCTCACCTACAGCCAGGTTTCTGGAGTGGCAGATGCAGTGGCTGATGCCGATTTAAC
ATCTTTCTGCGATGCTCTTTCAGTGGCATTCAATGTTTCTACTGGCGATCTTTATCAAGCCTTCCAAAACATCGGCTGTG
ATGTCGCCTCATCGAATGCCACCAATATCACTTGGTGTCTTCCTGAGGGCTGTTCAGTTTACCAGTCTCCAGACAACAGT
AGCTGGTAAGCACAAGATCAAAGCAACACAGGCAGAGAACAACAACTTTGATAGCTAACGCAAGACACAAACAGCACCGC
AGCTGTCCAGTCCGTGTCGACGGCGGAACACAACATCACCGTGCAACAGCTAGTTCAGTACAACCCCAACCTGCAGGGAA
CGTGTGATCAGTTGGAGCAGCAGTATCTTTGCATCACGCCGCCTGGTGGTGCCTATGTCCCACCGCCGACCAATGTGTCC
TCGACTGGTGCCGGTGAACAGCAACGAGGCGGTGGTGATGGAGGCTCGACCAGAAACCAAACCATAACCACTGGAAATCC
CACTGTGAAGGTTTCCCCTGGCGGCACCCCCCCCTCGCCGACGCAGCTTGGTATCAATGCCGACTGTGTCGTGTATAGCA
ATGCCTCTGTTGGTGACACCTGTGACGAGTTTGCTGAAGAGCACGACATCAACCCTGCGGATCTCTTTGCATGGAACAAA
GTGTTGGGCACGGATGGTGCCTATTGTACGACCGAGTTTTGGAGCGGCTACTGGTACTGTATTGGCACAGAGTCTTCTCA
GCCGTCGTCGACGATAGTATCGTTGACAACTTCGGCTACTCTAACATCCAGCGCGTCAATGCCCGCAGTGCCCCTCTCCC
ACGCAGTCCGGTATCGTGTCGTCCTGCGACCAGTATGCCCAGGCGGCTTCAGGTGACACTTGCTCTTCTTTTGCCGCTGA
TCACGACATAACGGCGTCCGACCTATACCAGTGGAACAAGCAACTCGGCACTGATGGCACCAACTGCTCAACCGAGTTCT
GGGCTGGCTACTACTACTGCATCAACGCTGGTATGGTGCCCTCTAATTCTGTTTCGTCTCCGGTCTCTGCTACCTCCACG
TCTTCGTCGTCGACCCCTGCTCCGACACCCACGCAGTCCGGTATCGTTTCCAATTGCAAAAAGTACGCTGAAGTGAGCAG
TGGCGACACCTGCTCTAGTTTCGCCTCGGCCAATGACATCACCGAAGTAGACCTCTACACCTGGAATACCCAACTCGGAG
TCGATGGAGAGGACTGCTCTACTGAATTGTGGTCTGGTTATTACTACTGTGTTAGCATATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62