GenePrediction:GLEAN_7956 Details

Name: GLEAN_7956
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2023230..2020855 (- strand)
Length: 2376
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2023230..2021378 (- strand)
Length: 1853
Type: CDS
Source: GLEAN
Position: GCSC_113:2021317..2020855 (- strand)
Length: 463
>GLEAN_7956 class=GenePrediction position=GCSC_113:2023230..2020855 (- strand)
ATGGCATGCAAATTGTGCCGAACCCGGAAGGTTAAGTGCGACCAGACTCGTCCGGTGTGCCAGAACTGCCAAGTGCGATC
GAGCGCGTGCACGTACGAAGGGGAGCGGCGGAAGCGTCGATGGGCCGACCACCAACAAGGTGGTAGCAGCGACAAAAATA
CGTTTGGTGGTGATATAATGTTCTTGAGCAGCGGGCCTTACTCAAGCGGCGGTGAGGCTTCCTGGCCGGAACGTTCGCTT
TCGGTCTCAACCACGACGAGAGGGCCGACTGTTGCCACGACCGACAACGAAGACTGCCAACAGCACGACCATGAAAGCAT
ACCACCGCTGCCAGCCGCCATGAAAAGACCGTCCATGAGCACAACTAGCAGCAGCAGTGTGACGGGACCGGGTGGTAGTG
CCAATGCGGGAAACAATTTGATGCGAAACAACGCGGTCACCTGGAGGCCTCAGCGCGGCCTCGGGCTCGGGGAGGCAGAG
ACGCTTCTTGACGGCATCCTGCAGAGCGAGGCCGAGGACGGGGCTGATAGCGCAGAGGAAGAGGCCCGACACCCGGCGAT
CTGGATGCGGACGAGCGAGGGAGACGAGTTCACGGGCCCGTCATCTGGGATCACGGTCATCTCGGACGTGGGTGTGCAGT
GGCTGCAAGAGAGGGTGCCGGACTCGGAGACGCTGTGCCGCACGATCCAGGATATCCGCGGCGAGCTGCTGGGACACCTT
CGGCAGCCCAAGTGCATCCCACGGGGACTTCCGGTGACGCCACAGGCTGCTCGTGGAATGGACCACCTGTCGGAAGCACA
GGTGATGCGGTATGTCGACGCATACTTTGTCAGCGTGCAGCTCATCTTTCCGGTGCTGGACCGAGCCGTCTTTCTAGGGC
AGCTGGAGCGCAACGGCCGCAACAACAGCGACAACCGCGACGTACGGCCTTCGTGGCTGGCCCTGCTGAGCGTCGTGCTG
GCTTCAGGCTGCCGGGCCACACTGTCGGACGAGACAGCCGAGGCCTTCCAGACATCCGGCCGCGAGGCCTGGCTCTTTTT
CCAGGACGCTCTCTTCTACGAGCGCAGCATGGCCCACGGCACGACTGAACTGGCAGCCGTGCAGGCGCTGGCCGTCATGA
CCGTCTTTGCTCAGGGGCTGTCGAGCCCACAGCGGCTTGAGTACACGCTCTGCTCACAGGCAGTGCGCCAGGCCCAGGCC
CTCGGTCTCAACTACCAGCCATCAAGAGCCTGGCAGCTGTCGTCGGCCGAACTCCGAGAGCGCAGCCGCGTCTTCTGGGC
CGTCTACTGCCTCGACAAGACCGTTGCCCTGCGCTGTGGCCGTCCGGCCATCCTCCACGATGCCGAGATCAGCTGTCACT
TTCCCCGTGGCGTTCCGGTGCTGCAGACGGCTACCCCGAGCTCAGACTCGGACGTCCTTCTGTCCTCTTCTCCCTTTGAC
TTGTTTCTCTACTTCACTCGCCTCGCTCGCATCTGCGGCGCCATCACCCGTCAGCTCTATTCGGCTACTGCCGTCACCGC
TGCCGCCACCCGTCTCTTATTCGACGCACAGCAACTCCTGCACGACCTCGAAGCCTGGCGACTCGCCATCCCGACCACCA
TCCAACCCGGCCGGCCGCTCGGTCGTATGCGCGAGGCCGAGCAGCTCACCCACCTTCAGGTCGTCATCCTACATTCTTCC
TACTACTACGTTCTCTGCGCCATCTACCGCCGCTTCAGCCCCCTATTTACCCACCACGATGAGACCAGCCGGGCCGCCAT
CTGCTCGCGCATGCCCGCCGCTTACGTACAGGCTGCCCGCTCTATGGTGCTGCTGACTAAGCACCTCGACACAGAGAGCT
TTACGCCTGGCTGGTGAGCTCCCTCTCTTTCCGGTTCCGTTCTGTTCTACGTTCTGTAATGTTGACACACCAGGCTCGTC
TTTTACTATCCACTGACGGCTCTGACTACCCTCTTTATGCACGTGATGTGTAACCCGTCAGACGGCTCATCCAGCAACGA
CATTGCCCTTATGGAGGCCGTTGTCGGTCTTTTTGGCCGTCTCGAGTACGTCACGTCAGGCGAGGCCGCCTTTACCAAGG
CAACCGAGTTTGTGCGCCAGGCTCGCAGTGTTGTCGACCGCTGGCACAGCGACCTGAACAGTGGCAGTCTCCCCACGACT
CACAGCCCGAGTCCGCCTCGGCCTCCCACCTGCTCACTATTTCCAGAAGAAGGCTTTTTGCTCAGTCCTGGCCAGACACA
CGAGGGTTACAATATTTTGGATCCCGGCTTAGCTGGTTTTCTTGCATCACCCCCCGGCGAGCTGCCCTCAGCCGATTGGC
TCACAAACTGGGCCGGCAGCAGCCAGATGTCGGCAGTTGAGATGGCTTACTTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62