GenePrediction:GLEAN_7957 Details

Name: GLEAN_7957
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2019726..2019130 (- strand)
Length: 597
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2019726..2019528 (- strand)
Length: 199
Type: CDS
Source: GLEAN
Position: GCSC_113:2019451..2019225 (- strand)
Length: 227
Type: CDS
Source: GLEAN
Position: GCSC_113:2019150..2019130 (- strand)
Length: 21
>GLEAN_7957 class=GenePrediction position=GCSC_113:2019726..2019130 (- strand)
ATGTCTTCCACATCCAAAGCAACCAGCAAGACCCAGTGGCTTTCCGACCGCCTCAGCCAGCCCATCAAGGACCTCATCTC
CAAGTTCTATGCACTAGCCGACCTAAAAGCCCCAGAGGCCGGTCCACGCATGGCCGTCGAGGTTTTCTCAGCTGACGCCC
TCATGATCACGGCCAACGGAACCTTTCATAGCTCCTCTGGTACGCGTTCTCATTCTCCCATATGTTTTATCTCTACCTTC
TCTTTGTGCGTTCTCTTGATCTAACACAAGTTTAGAAATATCCCGGAGCAGAGACAATGCCTGGGCTGTGGTGGCCACAA
GGCAACACCATGTTCTCCAGGTCTTCGCCGGTGATCAGGACGTCCCCGATATTGCTCTTATCGGCTCTCTTGATACGGGC
TTCACAAATGGAAAAACCCTGACCGCTCCCTTTGCTTCCCTTCTTAAGTTGGATTGGCCGACGGGTGCGGAACCTCGTAT
CAGGCATCTCGAAGTCTTTGCCGTAAGCTAAGTTACCAAGTACCTCGCACGACACACAGCCCACGATACTAAATCCACTT
TATATTCAGGACACAGCTCCATTTGCCGCTGCACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62