GenePrediction:GLEAN_7958 Details

Name: GLEAN_7958
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1997601..1995887 (- strand)
Length: 1715
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1997601..1997489 (- strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_113:1997435..1996977 (- strand)
Length: 459
Type: CDS
Source: GLEAN
Position: GCSC_113:1996921..1996863 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_113:1996797..1995887 (- strand)
Length: 911
>GLEAN_7958 class=GenePrediction position=GCSC_113:1997601..1995887 (- strand)
ATGACCTCTCTTACGATTCTCCCGGCGGACAAGAAGGCCGTGACGTCCATCTCGGTCAATGCGGCTAACACAATCAGCGC
AATCAACCCATTGATCTATGGCGGCTTCACAGAGTGCGTGTGTCTTTGATCCTGCCGTATCTAGTCCTTCTGGCTGACCG
TTACAGACACATGGGCCGCTGCATCTACGGCGGCCTCTACGAGCCCGACAACGCGCACGGGCTGTCGGACGACAAGGGCT
TCCGCAAGGATGTGATCTCGTGCTTTAAGGAGCTGCAGGTGCCGGTAGTCCGCTATCCGGGCGGCAACTTTTGCGCCAGC
TACCGGTGGCAGGACGGCATTGGGCCCGTGGAGAAGCGGCCGGTGCGGCCAGAGCTGGCATGGGAGGGCATCGAGCCGAA
CACGTTTGGCACAGATGAGTTCATGGCCTGGTGCAAGGAGGTGAGCGCGGAGCCGTACCTGTGTCTCAACATGGGCACGG
GAACGCTAGAGGACGCGCTGGCCTGGCTGGAGTACTGCAACAGTAACAAGCACACGTACTACGCCGACCTGCGGCGGAAA
AACGGCCACGAGGAGCCGTACGGGGTCAAGTACTGGGCTCTGGGGAACGAGATATGGGGGCCATGGTGAGTGATGGCAGC
TTGAGCGTGGGAAGCCTGGGGGCCCTGCTGACAAATACAGGCAGATTGAGCAGCACACCAAGGAGGACTATGCGAAGAAG
GCAGTCCAATGGGCTAAGGGTGAGTGTTGCCGAACCGGGCTGTGTTGTTGAGCATTTGCATTGTCGTTCCTGCTGACAAG
ATAGCGCTCAAACTGTTGGACCCGTCCATCACACTGGTCCTCTGCGGCAAGGATGGCTACTCGGACTGGGACCGATACAC
GCTGCAGCAGTGCATCCGGTGGGTGGACATGCACTCGATCCACTACTACTCCATGGGCCGTGACCACTACACCAACATCT
CGTCAGTGTACGGGGCCGAGCGGGCCATCCAGGTGTGCTCGGGGCTGATCGACGTGGCGCGCTGCGAGTTCGACATGTCG
GCCTATCCGGACACGGAGCGGATCTCGACGCGGCCGGCGAGCAAGAAGCGGCCGACGATCTGCTTTGACGAGTGGAACGT
GTGGGACCCAGATAGGGCGCCGGGCAATCTGGGGGCCGAGGAGCAGTACACGCTGAGTGATGGGCTGGCCGTGGCCGTGT
GGCTGAACGTATTTATACGCAACAGCCGGGAGCTGGGCATGGCCACGATCGCCCAGAGCGTCAACGTGATCGCGCCGCTG
ATGACGACGCCACGGGGCCTCTGGCGCCAGACGACCTACTTCCCGCTGCTGCTCTTCTCGCGCCACATGCGAGGCCAAGC
CGTGGCCGTTCACGTCCACACACCTGTCTACGAGGGTACGACCTTTCCCGAGTGGATCCAGACGACTGTGGCCGTGCCCA
AGCTAGACGTCAGTGCGGCCGTCGAGGCCGGCTGGCTCAGCTTGGCCGTCGTCAACTCGGACGATACGCGCGACTATGCC
ACCCGCCTCGACGGACTTGTGGTCGGTACTTCCGTGCAGGTCTTCCGTATCGGTGGCAAGGGTTTCGCGGCCACCGATAG
CAATGCCGATGGCGACGAGAAAATCGGCATTGTCGAGTCGGTCTGGGAGGCTACCGGCGACAGCTACACGTTTGAGCGGC
TCAGCTTCACGATGCTGCGCTGGAAGGTGGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62