GenePrediction:GLEAN_7960 Details

Name: GLEAN_7960
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1993302..1992042 (- strand)
Length: 1261
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1993302..1993227 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_113:1993168..1992872 (- strand)
Length: 297
Type: CDS
Source: GLEAN
Position: GCSC_113:1992769..1992042 (- strand)
Length: 728
>GLEAN_7960 class=GenePrediction position=GCSC_113:1993302..1992042 (- strand)
ATGCCGTCCGCCGTCCCCCAACTGTACCAGTACGCTCACGTCGAGGAGACCAAGGAGAACCTGGATTGGGCCGAGCGTGA
GTAGATGCGGTAGAAGAGACCAAAGGAGGTTGAATGGTTGCTAATCCGTCCCAGTACCCAGCATTGACCTGTCCAAATAT
GGCACGCCAGAGGGCAATGCCGAGCTTGCCCAGACCCTGGTTGATGCCATTCGCACCAAGGGCTTCTTCTACGTCGTCAA
CTTTGGCATTCCCCAGGACGAAGTCGACCGGCAGTACGCACTCGGCCAAGCCTTTTACAACCTCCCGCTGGACGAGAAGC
TCAAGTATGTCCCCGACTTGGAGCACGGCGACTACAATGGGTACCGGCCGGCTGGCCGCCGGCTTTTGAGCGGCGGCATT
TACGATAAGACCGAAGTCTGGAACATGGCGAGTGAGTGATGGCCATTACGTCCCTTTTTTTTTTTTTTTTTCCCTTTTCA
TCTATTTTTTCTTTCCCGCCGGCTGCTGCCCCCCAAGACTGACCGTTCTGCAGCAAATGACGGCCACATCACGCAGCCAG
TGCCCACACTGCTAAAGCAGAACCTGGCCGAGATCGAGGCCTTTGCCAAGAAGCTTCACGACAAGGTACTAGACCCGCTC
AACCACCTGATCGCGCTGGCGCTCGAGCTGCCCCCAGACTTCTTCACCAAGGTGCATCGCTGGGACGTGCACGACGAGTC
ACATCTACGCTACATGAAGTACTCCAAATTCTCGCCCGAGGAGATTGCCAAGCTGGACGACGGTCTCTGGTCGCGCGGCC
ACACGGACCTGGGCACCATCACGCTGCTCTTCCGCCAGCCAGTGGCCGCGCTGCAGATCCGCGACCACGAGACCGGCGAG
TGGAAGTGGGCCAAGCCGCTGGATGGCAGCCTGACCGTCAACACGTGCGATGCCCTCAGCTTCCTCACCGGCGGCTACGT
CAAGTCGACCGTGCACCGCGTCTCCGTCCCGCCCAAGGACCAGCAGCACGTCGACCGCCTCGGACTGCTCTACTTTGCCC
GCCCACAGAACGACCTGGTCCTCAAGACGGTCGACTCGCCCGTCCTCCGCCGCGCCGGCTACACCCAGAACGAGTTTGAG
GCCGGCGGCTTCCCCGTCCCGACCATGGGCGAATTTACCGTCCACAAGCAGACCTGGCAGCAAAAGCCAAAGGGTGTCGA
CTACAAGGCAACCGAGGGCCAGACAATTATTCCCGGCTTTGTCGGAAAGTTCTTTTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62