GenePrediction:GLEAN_7961 Details

Name: GLEAN_7961
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1979998..1978847 (- strand)
Length: 1152
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1979998..1979929 (- strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_113:1979853..1979838 (- strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_113:1979685..1979465 (- strand)
Length: 221
Type: CDS
Source: GLEAN
Position: GCSC_113:1979397..1978847 (- strand)
Length: 551
>GLEAN_7961 class=GenePrediction position=GCSC_113:1979998..1978847 (- strand)
ATGGCTCCTCCACCAGCTGCGAGCTTGCCGCTCACTGAGCGCCTGCTGACGCTCGCAAAGACGCTCCAATGTGAGAATGG
CCCGTTCCTGTGTCGCTCACGCGCGTGTATTCTAGCATTATGCTGACCATGCTACCCCAATCTAGTCGGTTGGTTTGTTG
GGTACGTTTCGCCATCCCCTCTCGCTGCGATCAGTCTACTGCTGCGCACAAGACCATATCTGGTGTGATTGAGAGGCCGA
GGAGAAAGAACACGGACATTCCAGTTCCAGAACATTTATCTACAGCTGGACAGAAACTAACATATTGCACTAGCCATCTC
ACCCTCATCCTGTCGACGCTGCGGTATTCGCTCTCGTGGATTCGCTTCAACTATTATGGCTTCTTTGCTCGATTCTCCTA
CCGCACCGCTTTTGTCGCTGCCGCGGCGACATACGGCATCGTTGTGTACAAAACCTTCCGTGCCAGATCCAAGAGTGGCC
GGTTGGCAGGCGGTCCGGCCGCCCTGCTTAGCGATGAGAACGTGCAATATCTGAGTATGTCTCCTGTTCTCCGACCCGCT
CTCCTTCCCCACTAATCAGGCAACCTTGCTACCTCTTGCAGTGCTCGCTCTCATCTGGCTTTACTCCTCGCAGTACATCT
TGGCTCTGCTCCCCTATACCATCTACTCTGTCTTCCATGTGGCCACATACACTCGCACCAACCTGATTCCCACCATCTCG
CCCCCCAAGCCGTTGGCCCCTGCCGCCGGTGCGTCGCCGAGCGCTAAGACCACATACACGACTCACCCGCTGTCCGACTC
CATTGGTCGCTTCGTCAAGCAATACTACGACTCGTCCATGTCTGTCGTCGCTTTCCTGGAGATTCTCCTGTGGCTTCGCC
TGCTGCTTTCTGCAATCACCTTTGCGCGCGGCTCCTGGATCCTCATTGCTATTTACTCTGCCTTCCTGCGCGCCCGTTTC
GCACAGAGCCAACATGTTCAGAGCACATTTGAGCAGATCGAGGCTCGCATCGACAACCTGACCGGCGCTCAGGGTATCAA
CCCCGTCGTCCGTCAGACCTGGCAGACCATCAAGACCACTGTGCGTCAGGCCTACGCGGCAACAGACTTGCAGAAGTACG
TCGGTGGCGCAGCCCCGCGCAAGGCTGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62