GenePrediction:GLEAN_7962 Details

Name: GLEAN_7962
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1978047..1976299 (- strand)
Length: 1749
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1978047..1977950 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_113:1977877..1976299 (- strand)
Length: 1579
>GLEAN_7962 class=GenePrediction position=GCSC_113:1978047..1976299 (- strand)
ATGGCTGCTTTTCTTCGCCGAATCGTTGCCGGACCGCGTGCTGAACACGCAGAAACCGGTCTTGATCTCTGCTATGTCAC
CTCTAATATCATCGCAACGTGAGCATCATACCACTTGATAAGGCCACGCAAGGCGACGCGAAATTAGCTAACAGGCCGCT
TCCATTAAAGTTCTGGACCGTCGCAGACATATCCGCAACTTGCCTACCGCAACCCGCTCGACCGCCTGGTCGCGTTCCTC
GATGCCAAGCACGAGAAGAATTGGGCCATCTGGGAGTTCCGTGCCGAGGGCACTGGTTACCCCGATAACGCCGTCTACAA
TCGCATTCGACACTATCCATGGCCCGACCACCACCCACCGCCCTTCCGCCTGGTGCCTATGATCGTGGAAAGCATGCACC
AGTGGCTGCAGGGCGAGGACGAAGACGGCACGACGGACAGGAAAAACGGCCGTGTTGTCGTGGTGCATTGCAAGGCTGGA
AAGGGCCGGTCTGGGACCATGGCCTGCAGCTACCTCATCTCCGAATATGGCTGGTCGTCGGAAGAGGCCCTCAACCGCTT
CACGCAACGCCGCATGCGGCCTGGCTTCGGTAGTGGCATCACCATTCCCTCGCAGGTGCGCTGGATCGGCTACGTGGAAC
GGTGGGCACGACAGGGCGGCAAGCGGTACGTGGACAGGCCGGTCGAGATTGTCGAGATTCACGTCTGGGGCCTGCGGCAC
GGCGTCAAGCTGGCCATCGAGGGCTACGTCGACGAGGGCAAGAAGATTCATGTCTTCCACACTTTTGGCGGAGATGAGCG
CTTTATCGTCGAGGGGAATCCACCAGGAGGCGGCGGTCTGGTAGACTTGGTGTCTGATATGGCAGGAGCACACTCTGGTA
GTCCAAGACGAGAGGCCGGAGCAGACAAGGCGAAAAAGGAGAGAGACAGGCCGAAGCAAGACATCAAGAGACCGGAAACG
GATAACGTCCTTGCAAACAATGCGTCCCAGAACAAGCCCTCGCTGGAGGACAAGAGCCGGTCGTCGCCGGCGTTGGTAAC
GTACAAATCCTCGTCACCACAGCCGTCCAGACAGCAGTCGTTCCGGTTTGCAGCACAAGACGAGCCAGGCGGCCAGGCAG
TTATCTTCAAGCCCAAGGAACCTATCCGTATCCCCAACAGTGACGTCAATGTGTGCATTGAGCGCCGAAATAGGACGGCA
CCCAACATTATGGGCCTCACAATGGTGACATCCGTGGCTCATGTTTGGTTTAACGCCTACTTCGAGGGCAACGGGCCCGA
GCAAGACGGTCAGCCTGATGAGAATGGTGTCTTTGACATTGATTGGGAGAAGCTAGACGGCATCAAGGGGAGCAGTCAAA
AGGGGAGCCGAGCGGCTGATCGACTGGCGGTCGTGTGGCGGGCAATAAAATCGGCTGACGAGCAGAAGACAGAAGAGGAA
AGCGTGCCGAAGTCTACAGCGGAAGCAGTAAGTTCAAACGCCGCTGAGGCGACAGCCACAGCTATATCGCCTGGAGAAGT
CCCACAGATGCAACCGGCCGACTGGAGAGGCGGCAACCAAGAAGACCCAGAAGCCGGCAAAAGCTTGGGGTTGCGCAAAG
AAGACCCAGACAGTGGAACAGTTAGCAAAGCGAGCAGTGTCCAGGGTGTGCCTGTCGGTGATGGTGGTAGCGATGCGCTG
AAGGGGGTCAAGACCACCGGACCAGGAGGTGAAGCCTTGGCGTCAGACAGCAAAGGCAGCAGTATATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62