GenePrediction:GLEAN_7964 Details

Name: GLEAN_7964
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1974626..1972028 (- strand)
Length: 2599
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1974626..1974285 (- strand)
Length: 342
Type: CDS
Source: GLEAN
Position: GCSC_113:1974205..1972028 (- strand)
Length: 2178
>GLEAN_7964 class=GenePrediction position=GCSC_113:1974626..1972028 (- strand)
ATGGCAACGCTGCAGTCTACCTCGTTCCTCTCTCGAACGAGATCCGGTCGCGTGCCCAGTGCCAGAACAGCGACTGCGAC
AGAGTCATTAGCGATCCCTCAAGCTGGTGCTGGTGCCGGCCCAAACATCTCCTTGCAAGCGCCGCTGTCCCCGTCCAACG
TGTCGATTTTCCTTACCAACCTCCGCCTTCTCGACCTCGACCTCGAGCCTGACTGGCCAGACATCACAGCCCGCACGTTT
TCAACAAAAGATGCTGGTCAGGGCCAGAAGCGGCGAGTCCAGACGGTAGAATGGGCGTTGTACCAGCTCTTCTGCCTCTG
GGACCCGGAGGAGACGCTCAGCGTAGGAATAATTCTGCTCTCCCCGAAAAACTTATGGCCGGGCCACAGCTTCGCTGACG
CAGCTTCTTTACGGTCTCCAGAAACTGCAGCCCTACTTTCCACCAGCAGACCAAGTGCAGTCTGTAAACCTGCGGGCCGC
CCTGCTTCGAGCTCTCGAGCAGACAAAGAAGAACGGCACACTTGGCCGCGATGTCATCATACGAAAGACGATGCTGGATG
AGTGCCGGGGCGAGCGACTGGAGGAGGTGCTGGCCGTCTTCTCGTCGGCCGTCCTGAAGAAGGTGGTGGCCGAGGACCAG
CTAAACGAGGGCGGCAGAGAGCAGCATCCAGCTGCGGCCAAGTCTCTGGCGCTGGAGGACTGCGGATACACGGGCGAGCG
CACGCCACTCACGGGTCTGATCCTGGCCCATCGCGTCTCGCTCAGCCGCGATCTGCGAGCCAAGGAGACGGCACGGACTC
GGTACAAGGACTTTGCCGAGCTGCTGGACCTGAAGCAGCGCAGCATTGTGCAGCGCCAGGAGTGTGCAGAGGCCTTGGAA
GAGGCGGCAAAGAAGAAGGGAGGACAAGAGGTTATGTCAGATGACGCCCGACTGCACGTGTGGCGGGTAGTGCGCAACAA
CTGGTCGGGTAGCGAACAGTGGATGGAGGCGCTTCTTTGCGGCGACGGTGACGGAAGAAGCAATACTACGAGCAAAACGG
ACAGAGACGCTGTGCTGTCGACACCGTACGACCGCGTCTGGCGACGAGTGCAAGCCGGCCGACTGGGCGAGCTCGAGGGC
CACGGTGGCCGCGGCTTGTTGGAGCAGCTTGACAAGCGTGCCAACCTGCAGCACGAGAGGCTGCAGAAGTGGCAAGACTA
CCGCCGCACTGTTTTCAAAAAGAGCGCCAGCGAAGAATCCTCCCTTGCGGCAAAGACAGCTGCAGCAGCATCTGCGCAAG
GAAAGAAGGGCATCGATCTGGGCTTTGGGGCCCATGGCGGACTCTATCCGGCCGCGGCCAGTCCAAGGAAGAGAAGCGCC
CAGGAGACAGCGCCCATGCGGGGAGAGTACGCGGACCTGATCAAGGGTCTGACCGCTGAATTGGCCAATGTTGACCAGCC
GTCGGGACAGCAGTCTCTGACGGCCTTTCTGCAGGCCAGGACGGCTAGGCTTGCTGGCGGCGCAGCGGAGACAAGAGAGA
GGAGGAGCAGCAGCGGAGGGGGGCTAGAGGAGGCTGAGGTCTCTGACATCAGCGACTTTGAGGACCACGCGGCACCAGAG
CAACCGATAGCACCGCAGACCAAAGACTTGATGCTGTCTCCCCGGGTCGGGCAAAGGACGTTGCTCAGCAAGGCGAGCAT
GACATTCAGTGTCACGACATACGACTCAGACGAAGATCTGGAGCCGCCGGCAAAACAGTGGCAGCCGTCATCGTCGCGGG
CCGTGTCCGGGTCCGTGTCCGAGTCGAGGTCGGCATCGCTGGCATTGCCGCCTTCTGCGCATGCAGCAGCAGTAGCAGCC
CAGTTGGAGGCCCTCGACATGCCCATCCGACCGCTGCAGTCGCCCCCAATATGGCCCCGAACGCCTTCGGCAAAGACGGC
AGACGAAGTCGACAGGCTGCCGCAGACGCCAGTTCCCGAGGTTACAGTGTATATGCCCGACGACAGCCCCCGGTCACCAT
CGCCATCGCCGCCGCCACCGTCGTCGCCACCGGACGCGCTGGCGGACGAGATCCTCGCGTCGATGAGCAGTGGGTCGCCA
TCACCTGTCAAAAAGCCCAGGCACACGCTTTCGCTAGCACAGCGCACGCAGCTGTCTCTGGCCCGCACTCCTCGTGGGGC
CGCGATGGGGAGGATGGGAGAGAGCAGCTTGGATTTCGATGACGACGACGACGAGCCCGACCTCCATTTGCTGCCCAGCC
GACGAAACACGACTCCGGTGGCCGTGAAGGTGGGCAATGCCGAGGACGAGGCGCCGGAGCACGAAGATCTGGTGGCGAGG
ACACGCAGAAGCATGGCCGGCTTCGAGGCGTCGCGGCAGAAAGCACAGCTGGAACGGCGACGGTCGCAGCACCAGAGCAG
ACAGCTGCCATCAACACCGTCAGCGACAAAGTCTCTGGCGCATTTTGACACGGTGGAGGAGGGCGAAAATACGCTGATCC
TGGCCGAAGAGCTGATGTCGGGCGAGCAGGACGACGCCGAGGCCATCTTCCGAAGCCGGCCGAAGATCAAGATGAGCCCG
ATCCCGAGCCCAACGCGGAGTCTCAGTCGAGCAGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62