GenePrediction:GLEAN_7965 Details

Name: GLEAN_7965
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1970775..1968168 (- strand)
Length: 2608
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1970775..1970754 (- strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_113:1970684..1970616 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_113:1970554..1968168 (- strand)
Length: 2387
>GLEAN_7965 class=GenePrediction position=GCSC_113:1970775..1968168 (- strand)
ATGGCTTACAACCCATACGGAGGTACGTTCTGCCCCAGCCGGCCTCACTTCGGATACTGCTCTAGATGCGCATGCTAACC
ACCCGCTACAGGGAATCCCTACGGGGCGCTTCCGAACTACAACCCGTATCCTGGCGCTGGCCGTGGTCATCCGGGCTTTG
GTACGTGTTCTGCTGTTGGCCGTTGTCGTTGCCTGCCGTCCAAGCACTAACCTTCTTCAAGGCCCGCCTCCAGGCATGTC
TCCTGCTCCGGGATTGGCACCACCACCTGGTGTGCTACAGCCGCCAAGTGCGACACAAGCTAATCGACCAAGCGGACTCC
CCCCTTCCTTCCAACCACCGCCGAACCTGCCTAACATCAACTTCAACGCGCCCGTGATCCGGTTAGGTGGTGCCGGTGGT
GCGTCGTCTCTGCCGGCACGACCAAACGCACCGACCGGGCCTTCGTGGCGCGAGCCCGACACGCCTCACTCTGCCGGCGG
GCCGATGCGTCACGACTATGGCCGCTACGACAGGGGCGGCGGCATGGAGCAGGGCAGTCGTGGCGGCACCACGCGTGAGG
TCATGCACTCGCTCTCTCCACCGACCAACGACGAGAAGCTGCGGACGATCTTTGTGCACAAGGTGCCGCCCAGCCTGGGC
AACGGCCAGGCACTGGAGGGACTGTTGAGCCTCGTCGGCCGGTTGCGACGGTGGGACGCCGAAGTGTCACACCTGTCGGA
CCAGAAGGGTGAGCTCTTTGGATTTGCCCAGTATGAAGACGCAGACTCGCTGGATTCGGCTATCGAGCTGCTCAAGGGCG
TGGAGGTGCCGCTGAAGAAACAGGAGCCCAAGGACACGACCGGCCAGGACGCCAATGGCACAAAAGAGGACGGCGGCAAA
GAGCAGGGGAAAGAGGAGGATGGCAGCTTCGAAGGGATTGAGAAGGTGCTGCTGCAGGTGGCTGTGGACCCGGTCAGCCT
CCAGTACATTGAGGCACACAAGGAAACACAGAGCGACGAAGCCGCAGCAGATGCCAAGGCACGGTTGGAGTTCAGCCGGA
GGGCTCTCAAAGCGGCGATACACGACCTATTTTATCCGCCAAAGAGCGAGGCAAGAGATGCTGACAACGACGTCAAGATG
ATGGACGTTGGCGGACTGTCTGGAGAGGGAGTGGAAGTGCTGAACATTCCACTGGCACAAGACGACGAGCTAGCAGACAT
TCCAGCAGAGATGCGGGAAATTGTAGCGTCGGAGATCGCGTCATTCCGCGAGCGCAGCAACCGGCGAGACATGGAGCGGC
TGAAGCGAGAGCAGGAGCTAGAGGAGCAGGAGCGGCGACGAAACGGCGAGATGGACCACCCCCGAGCATCGCATGCCGAC
TCATCAGCCCACATGAGCTCAAACAACATCCCGCTGGGGCCTCGCGGCAGTGGCGGTGGTAACAGCGCCGCGCTCGCACG
CGGGGTGGCTCGGGGTGTGAGCTTTGTAAACGGCAGCGGTGCTGCGAATGGGAAGAACGAGTACGAGCGCGAAGACAGCG
TGGACACGGACGCGAGCGACGAGGAGATTGTGCGACGCGAGGCGCGGAAGCACGCAGCCGAAGACGAGGCGATGTACAAG
GAGGCTGAGCGTAAGTGGGTGAATCGCGAGCGACAGCGGGCGGCAGCACTGGAGCGAGAGAAAGAGCGTGACCGAGCTGA
GGAAGACAACTTGGTGCGGCATCGCGAGGAGCAGCTGGAGCGGGAGAAAAACTGGGACGACGAGCGAGAGGCCAACCGCA
AGAACAGCCTGTACTTCCGGGATCACGCAGCATGGCTACGCAAACGGGCACACGACCGGGCAGAGGAGGAGGCACGTGAC
GCAGCAGACCGACGGACAGAGCGGGAGGAGCTGCGGCGACAGGCGGCGGATATGGAGGCGGCACGCGGCATGGCCGACTC
CTTCTTGGCCCAGCAGGCGCAGGGGATGGAGCGGGCACAGGAGCGGGAGCAGGAGCGGCGGGTCAAGGAAGAGGCAGCGA
AGATGGAGGCAGGAGGTGGAGGACTGGGAGGACTGGGAGGACCGGGAGGACCGGGAGGACCGGGAGGACCGGGAGCAGCA
CCACAACGGGTGACGATCTCGTTTGGTGCAGCAGCACAGCGAGCACAAGCACAGCGAGGCGGGGCGACGCGGCGGACGGT
GGCCGAAGTGGAGGGCTTACTGGACGACGAAGAGCAGGAGGCGACGACGAAGCGACAGCTGGTGCCGATCAAATTCGAGC
CCATGTCAGCATCGGCCAGCATGACGGACGAGGAGATCAACCAGGCGGTGCGGGCACTGGCACAGGAGATTCCGACGGAG
CGCGCGGGCTTGTGGGCATGGGACGTGCAGTGGCGCTTCATGGACGATGCGGTGATTCGCGACAAGCTGCGGCCGTTTGT
GGAGAAGAAGGTGGTCGAGTATCTTGGCGTGCAGGAGCAGTTCCTGGTCGAGGTCGTCGAGGAGCATCTGCGCCGCCACG
GTAAGCCTGAGGCGCTAGTCGAGGACCTGCAAGAAGCTCTGGACGAAGCGGCCGAAGACCTGGTCAAGAAGCTCTGGCGC
ATGGTCATCTTCTTCACCGAGAGCGAGAAGCGGGGGCTGCCAGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62