GenePrediction:GLEAN_7967 Details

Name: GLEAN_7967
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1966572..1965261 (- strand)
Length: 1312
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1966572..1966145 (- strand)
Length: 428
Type: CDS
Source: GLEAN
Position: GCSC_113:1965912..1965261 (- strand)
Length: 652
>GLEAN_7967 class=GenePrediction position=GCSC_113:1966572..1965261 (- strand)
ATGTCGGATACTTTGCGACAATGGGCGCGAGACCTGCGAAGACGACTAGGATATCGAGCGATCTCGAGAGCGGAAAGAAA
AGAGCCCGAATTGCCATACCTTCCTGAACGTTCGCCTGTTCCGTGGACTACGCCAGAGGACAGCACAAATGGAACGGCCG
GTAGCGCGTTGTTCACACGGCTGCCACCAGAGATCCGCCATACAATCCTTGTCATCGCGTTTGGAGGCCGCACGTTGCAC
ATGAGCCTGCGGCTCGGCGCACCACTGCTGCCGCGATCGAAGCGGCCACTCCTTGCCAATGCTCTGCAATGCATGCCCCA
CGGCGGCATCACCGCCGCTATCGAGGTTGGGGTTTGGCCCAATGAGGTGATGGATGCTGCACGACGCGTGCGGGAGGCCA
CGCCGGGAACCAAGCCTGTCTGGCAATGGTGCGCTTGTGTGTGCCACCGAAATCTGCCTTTCGGAGACGAGCGAGTCGTG
GTCGCGCCATGGGAAGACACTTGTGCCACGGGCGTGGCAAAGTGGTGCCGTCTGTATCCGGGCGAGTCCCCGGACAACTG
TCTGATCGGCTGTACTGGATGGCTGACAACGTGTCGCCAGGCGTGTGTACCCTCTGCCTGCTTCAATGTCTCTGTTCGTC
GGCTTACTTTCCTCGTCCAGGTACACCGAAGGAATACAAGTCCTGTACGGTACAAACACGCTGTTCATAGAGGGCGGTCC
GCTCATCGCAACACTGCTCCAAGCATCGTCGCTGGTGTTGGGCAGCGCTCTCTCCCGTCGCATTCTCGTGCCGCCTCGTC
AGATGGCGCTGCTAACAAAGTTGGAACTGGTCTGGCAATGGACGCTGTTTATGCGGCCCGATCAGGTCAAGGCGCAATCC
GCCAATCGGTCAGAAATGGCACGAAGCTTTGACCTGCTGCCGCGGACATTTCCACACCTGCTTACCCTCTATATCTCTTA
CCTGGACGGGCTCTACGATAGGTCTGTGCGGCCCGAAGAGTATGAGGCCGAAATCGAGCAGGAATTATTCCTGCCCCTGC
ATCAAATGGCCTGTCGGTTTGGCAGACTGGGAAAGTGTATCGTAGAGATTCCAACAGTCGTGTTCCAGCCACTCCTGGCA
AGGGCAAAGAAAGGCGGAAACGAAATCGACCAGGGACACTCGTATCACGACGTTCGGTTCTGGTGGCAACCGGAACCGAT
GCAAACAGGGAAAGTCGGACTCTGGGTCAAGTCGGGCATCGAGGGCAATCTCTTCTTCGATCACAAGGGTGAGGCGAGAA
CCCGTAATACGCAGCTTAGCATATTGTTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62