GenePrediction:GLEAN_7968 Details

Name: GLEAN_7968
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1960475..1958953 (- strand)
Length: 1523
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1960475..1959295 (- strand)
Length: 1181
Type: CDS
Source: GLEAN
Position: GCSC_113:1958962..1958953 (- strand)
Length: 10
>GLEAN_7968 class=GenePrediction position=GCSC_113:1960475..1958953 (- strand)
ATGTCCTTACGCCACTGCCTTTCATGCTTCGTGGCCAGTGCTGCGCTGATACAGGGCACTCTGGCCGGCAACCGGGCATG
GGAGTCATCCCTGCGATATCTGGCCCCGCCAGAACGACACCAAATCACGGTGGACGGGGCGGGTCATGCGTTTGTGGACA
ACACGACAGTGAAGCGTCTTGCTGAGCGCTACCTCTCAATCCAGCCCGATGCCGGGACGTCTGGCTTCAAGATCTGGCCA
TCGTCGACCATCAGCTTCTGCTTCGAGACGCAGAACGCGCGCGACACGCTGTGGGAGCATCTGGAGCTGGCCATTGAGAC
GTGGCGCACCGACGGCGAGGGCGGCACCGGCCTGCACCGCGACGTGTACAAGTACATCGAGGTCTTTGACCCGGGTGCCA
GCTGCGTCAACAACAAGCAGCGCGACCGCGTGCTGGTCATCAGCTACAACGCCGAGGGCCGGCTGTCGACAACTATCGGT
ATTGCGGCGCTCGATGCCAGCGCCCCCGAGTACAAGGGCCCCTCGATGGCGCTCTCGGACAAGGCTGGCATCGGCATGCT
CGACATCGTGGCCAACTACGCGCACGAGATCGGCCATTCCTGGGGACTGTACCACGAGCACCAGAACATCAACTACTGGG
GCAGTCCCTACAATACCGGCTCCTTTGGCAGCGCCATCTTTGGCGACAGCTTCGACTGCACCGTCCTCAAGGACTACCCG
GACGCCATCTCGCGCGCCAAGGCCTCGGGCGACGGTGACGATGACCTGCTGTGTCACTTTCGCGGCGTCGCGGCCAAGTA
CAAATTCAGCGCCGTCGACTGGCTGCCCATCAACGGCCGGACACGCATGCATCCCGGCGCCGGTGGTGCCGGGCAGTCTG
TGCCCACATACGCCAACGTCGACTGGAAGTCCATCATGTTGTACCCCAGCGGTGCCGGGGCCATTGGCGAGGCGGCGCCC
CCGGGCGGCGACTCCGACAAACGGTCCAACGTGCTGCTGCGCAACGACGGCCAGAAGCTGGGCATCAACCTGGTGCCGAG
CGCGCTGGATATTGCCGGCGTGCGACAGCTGTACGAGTCCGATCTCGGCACCGGCTCCTTTTCCGGCCTTCCAGTCTTGC
CCAACAGTAAGAGCAGCAAGTTCTTTGGCAAATTCAAGGACTCGTTCAAGAAGAAGAAGGGGTGTTAGTGGCCTTCTGAC
CCACTTAAGTATTCTTCCCTGTGATTGGTCAGTGTGGACACAGTGGGCTCAGACACTAGTATCAAAACAGATCCCAGAAG
GGTCGCGATGTATCTATTTTCTCCTTAGTACACCTTACCATTCAGTCTCCTCCTCCTTTTAGTGCAATACACCTTCATAC
GAATGAAACTAGTCCTTGTGACAGTTGGTCTTGTATATGTTGAAATTAGGATTACTCATACGACTCTGCCTACCATTTGG
AAGATACTTTTGCACTTGGTGCAAGTGGTATAGCAATTCAACAGTTTGAAGGCTATCTGCTCGCCGATTCCAGCTACCTA
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62