GenePrediction:GLEAN_7970 Details

Name: GLEAN_7970
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1953829..1948244 (- strand)
Length: 5586
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1953829..1953682 (- strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_113:1953621..1953128 (- strand)
Length: 494
Type: CDS
Source: GLEAN
Position: GCSC_113:1953067..1948244 (- strand)
Length: 4824
>GLEAN_7970 class=GenePrediction position=GCSC_113:1953829..1948244 (- strand)
ATGGCCCAACAGATGGCCACTTGGTACGAAGCGGCCTCTCCGCATCGGCAGGATGTCCTGGGCGAATATGCTGGCCACGA
GCTGTGCGCGATCCACGGCGAGTCGTTGCTGATGCATTGTCTCGAAGAGGCCCAGGTGGATTTCCAGGGTACGCACGTCC
GCTCTCCTACCCCGCACTCGGCTGTCGTCTAACTGCTCTCATTCACAGGAGGATTTCAGATGCTGCATGCCGTCCACGCT
GTCGAGACATTTCTGGCCAAGCTGCGGGACCGAGGCTGCAATTTCCACGTCATCTGGTTTGCCGACCACGAGGGCCTCCT
GGCTCCCCAATCCACGCTCGACAATGACAACGACTGCAGCCCGGTCGAGAAGCATGTCCGGGCAACAGCTCTCAGCAAGC
GTCGTCTTGCCCGTGCTGTGGTGATGCGTCATCTACAGCTGTATGCCGACAAGATCACACCGCCCAAGCCAATCACTTTT
GTGTTCGCGTCCATGGACTGCCAGGAGTACAAGGACTACCAGGCGCTCCACCCGCTCCGGCTCTTCTTCGTGTCGGACGG
TCAGATGATGGCCAGCCAGAGCGGCTCTGAGGCGGGAGCTGAAGACGGCAGCGTCTTGACCTTCCAGAGCGTCATGTACC
GCCTCAACACAGAGGGCTACACCGTAGCTCTTATTGACGATGTCGAGTTCGTCAGCTCAGAGGTTAGTTGTCCGGTCCTG
GTCTTGTCTTTCGGCCCAACATGCTAAACATGCTTTCCCCAGGCCCGAGCATCACTCTTTTCAGAAACCTCCGACCTGCC
GTTTGCCAAGGAGCTCTGGCACTCAGCGCCGGCCCCCAAGACACACATGCCAGCCAACATTGACGTTGGTCTGATCTACG
ACCGAGTCGTGTCCGAGTTTGAGAAGACAGAGGCAGAAAAGGAGACGAGCAAGTCGATTCGCGAGCTCATCTCGATGGCT
GCCCTTGCCGCACTCTTGGAGGTGGACGGCAGTGCGGAGATGCGGAGCCGAGCTGCTGCATTTATCGTGCACCAGATCAT
GCTGCAGCACTGCCCTCTTCCTGCTCGGCCGGCGAAACCAAAGTACCCGACAAACGCAGATGAGGCAGAGTTGGACAGCC
TGTTCATCAACAGGTACTCGGACGCGGCGCGAACGCTGGTGGGAAGCCGTCAGTGGGAAGGCAAGGAGATCTGGGACGCA
TACGACCTCGTGGACGGGCGGATCTGGCTGTCGGTGATGGGAGGCCTGGACACCAAAGCAGTTCCGCAGGGCCTCTCATC
CGATGCCGTCCGGCTCTGCAGGCGGCTGGCCACAGTGGTCGGCATTGTGGGAGGGGTGGACCTCCTGTGCCACTTCACAG
ACGGAGCCTGCTCGACGTCTCAAATTTCCTCGGCTTCTGCTGCCAGTGCAGATATCACTCCCGAGGGCTCAGTCCTTCCG
TTTTCGCACCACGACTTTGACGAGATCCTGTCCAGTGTCTCAGTCACGACGGCCGGCCCGGAACACAGCGGCAAGGCATC
GGCTACGGCCAAGTTCTCCACACTGGAAGTCAGCCACAGCTCGAAGAAGCCGGTCGCGGGCAAGGTTGACCCCAAGGCGC
AGGCGCGGGTGCTGCGGCGGAACCAGCGGTTCATGGCAGAGATCATCGCGTACGCGGCCAGCCTGACGAATGCAGCGGGC
AAGGGAATCAACCCCGAGACGATCGTGGTGGCGCCTCCGGCGTCGGCAGGTGGCGGGAAGAAGGCCAAGCCGAAGGCGGT
TGTTGAGGAGGCCAGCCGACAGAAGGCGTCCAAGGCACCCAAGGCGCTCAAGGGTAAGGCAGGAGCCAAGAACGACTTCA
AGCAGAAACTGCTGGAGCAGCAGCAGGCGCTGCAGTCGTCGAAGCAGGCCGACAAGATGGCAGCGGTCAGTGCGACGTGG
GGAGTGGCCCATGCCAAGCTGACGGCCGAGAAGGATCTTCTGAAGCAGTACCGGGCGACGGTGAACTACTTCCGGAGCCG
GGCAGTGCTGGAGCCGGACACGGCGGGGTCGGACGTCCTGCTGCTCATCTGTAGCATCCTGGGCCGGGTGCTGGCGAGTG
AGGCGGGGGCGAAGATACGGCCAGACATTAGCGCGCTGGTGTGGCTGCAGCTGCAGGAGATGAGCAAGCTGCCGCTCTCT
GGCGAGGCGGAGAAGCTGGCAGAAAAGCTGGCGGGCAACCTGGGCTTCTCGCTGGCGCTGACGGCAAGCACGGCGTCGCC
AACGTCGCCTGCACAAGCTCTGTTGTCCAAGGCTGCGATGGCGGAGGTGCTGAAGAAGCTGCGGGCAACGACATTCCCAC
GACCGACAGTGGAATCAGAATTCGAGCTCGGGTACTGCGGCCCGTACCTGGATCGGGGCTTCGACTCGCAGGCAGACGCG
CGTGCAAACGATTTCAAGCCGGACCGATGGCAGCGGCGGGTGCTGGATACGATCGACGCACGGCGCAGTCTCTTTGTGGT
GGCACCGACGTCGGCAGGAAAGACGTTCATCTCGTTTTACGCGATGAAGCAGGTGCTGCGGGAGAGTGACGAGGGCGTGC
TGGTGTACGTGGCGCCGACCAAGGCGCTGGTCAACCAGGTGGCAGCGGAGATCCAGGCACGGTTTTCAAAAGCGTACCCG
AACGGCGGGGGGCGGTCGGTGTGGTCGATCAAGACGGGCGACTACACGATCAACAATCCGACGGGCTGCCAGGTGCTGGT
GACGGTGCCACAGATGCTGCAGAGCCTTCTTCTGTCGCCGGGCAGCGGACGGGGCGCGGACAGCAAGAGCTCATGGGCGC
GGCGGATCCGGTGGATCATCTTTGACGAGGTGCACAGCATCGGGCAGTCGGAAGAGGGTGTGGTATGGGAGCAGCTGTTG
TTGATGGCGCCGTGTCCGATGATTGCGCTGTCAGCGACGATTGGCAATCCGAACGAGTTCCGGGCCTGGCTGGACGGGAC
AGAGAAGGCCAAGGGGCGCGACATGGAGATGATTGTGCACGGGTCGCGGTACTCGGACCTGCGCAGCTACTTCTGGAAGC
CGGCGACGCTGCGGGCGGAGACGCCGTTCCGGTTTACGGGCTTTGGGCCGGTGCCGAGCCGGTGGCCGATCCCCGGCCTC
GAAGTGGACGGCTGCAACTCAGACACGCCTTTTACGTTTGTGCACCCGATGGCCAGCCTGATGGACCGAGGACGGAACTC
GCTGGACGACATCACGCTGGAGCCGCGTGACTGTCTGACTCTGTGGCGCAGCATGCGGAAGCACCAGACGGCGGCATTTG
CGTTGGATCGACAGCTGGACCCGGCGGTGGTGTTTGCCGGCAAGACGGTGGCCAAGGCGGACGCCGTGGTGTGGGAGGGG
AAGCTGAAGGCGGTGCTGCTGCAGTGGATGCACGCGCCGGACTCGCCGTTTGTGGCGGTGCGAGACGAGCTGAGCGCATC
GTCCGGCATGACAACAACGACAGACACGAAGCGATACGGGACGAAACACACACTAGAGCTGCTGTCGGACCTGCGCAAGC
GCGGAGCGGTGCCAGTGCTAATCTTCATCTACGACCGCAAGCTGTGCGAGGAGACGATGCAGAGCGTGGTCGGGCAGCTA
ACGGCAGCCGAACAGGGATGGAAGGACACGAGCCCGGAGTGGGCCAAGACGATGGCCGACTACGAGGAGTACCAGCGAGC
CAAGGCGAAGCGCGAGGGCAAGGGCGACAAGGCGAAGAAGACAAAGGGCGGCGGCGACGACGACGAGGGCAAGTCGCGAC
TGGACAGCATGCGCGAGTCGGGCAGCGCCGAGTCGAGTCGGTGGGACGGATTCGACCCGGAGGCGCCGCAGGAGCGGTTC
AGTCTGGCAGACCACAGCAAGCTGGCCCGTTCAGAGCTGCTGGAGCATGTGAACAATCTGCGGTGGGCAGACCTGCCACC
GGTCTTTGTAGAGGGCCTGCGCCGTGGCATCGGTGTGCACCACACAGGCATGAACCGGAAATACCGGCAGACGGTGGAGA
TGCTGTTCCGGCGCGGCTTCCTGACGGTGGTGGTGTCGACGGGGACGTTGGCGCTGGGCATCAACATGCCTTGCAAGACG
GTCGTGTTTGGTGGCGACTCGACGGAGCTGAACGCGCTCAACTACCGGCAGGCGGCCGGTCGAGCTGGCCGTCGTGGCTT
CGACATCCTGGGCAACATTGTCTTTTACGATCTGCGGCCACAGCGGGTGTTGGAACTGCTGTCGTCGCGGCTGCCGGATC
TGCGTGGCCACTTTGCCCTCAGCACGACGCTGGTGCTGCGGACACTCGCTCTACTGCACCAGACGGCGACCGACGGAGCC
GAGGCCCAAGCATATGCGCGCCAGTGTGCCCGCTCGCTCTTTGCCCAGACGCACATCTACTTGGGCGGTGCGACGGCCGA
AGCAGCCATAGGACACCACTTGCGCTTCTCGATCGAGTTTTTGCGGCGTCAAGACCTGCTTTCAGCGGCTGGCGTGCCGC
TTAACCTGGCTGGTCTTGTGGGCAACCTCTACTTTGCCGAGAACGGGGCGTTTGCGCTGCATGCGTTGCTGCGCGACGGC
TATCTGCACCGACTCTGTGCCGGACTCGCGCACGACGTGGAAGGGACGCTGCAGACGCTTGTGCTTGTGCTGGCTCATCT
GTTTGGCCGCCATCCGTGCCGACGCCACGCCGACCGTGAGTGGCTCGAGCACACGGTGCGGCCGTCGGTCTCGGTCGTGC
TGCTGCCCGCGCTGCCGGCTGAAGCGGAGGCGGTGGTACGTGCTCACAACGCGGCCGCGCTGGCTGTCTTTCGCACCTAC
GGCCAGAGCTACGTGCGCCAGCATCTGGCGGCCCAGCCAGACGACCTGCTGCCGCTTACCGGACAGCACGTGCGGGCCGA
GGAGACGCTCGATCTTGGAGCTTCTTTGTCGGTGCAGCGGCCGGTGCAGCTGCGATCGCCGTTTGCCGCGCTCTCCGGCC
TCACAGACGAGTTTGCGTCGGTCCACGATCTCTGCTCGTCTGCGCGCGCCGGCCTCTTTCTCGAGGAGTCGGCGGTGCCA
TACGTGCCGATTGCGCCGGCCGACACGGACGGCGTGCCGCTGAACGCGTACCTGTACGACTTTTTCCGGCACGGCGACAT
GGCCGTGCTCGTCAAGGCCAACGGCATCAAGGACGGCGACGTGTGGTACTACCTGCGCGACTTTGCCCGCGTCCTGACGA
CGGTGGTTAGCAGCCTGAAGAGCCTGGCCGACCCGCTCGCCGATATGGACGACAACGACGATGGCGACGACATGTCGGGC
GACGACGAGGACCGGCCGCGCCCGGCGCCGTCGGCATCTTCGGACGGAACGAAGACGCTGGTCGGCAGCACTGTGTCGTC
GGTGGTTACGGGGCTGACGAAGCCCAAACGCAAGGTCGTGGTGGACTCGTGGGATGACGAGGACGATGAGGACGATGAGG
ACGATGAGGATCAGGAGACGGTCGTGGACGAGGCGGACGAAGCACCGGGCGCCGATCTCAGCGCGGAGGCGCTTAAGACG
GTCATTGCGGCCTTTAGCCTGCTCAAAGAGCGCTTCGACGAGAAGTTCCAAAAGGTGTGGGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62