GenePrediction:GLEAN_7972 Details

Name: GLEAN_7972
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1932710..1931795 (- strand)
Length: 916
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1932710..1932708 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_113:1932358..1931795 (- strand)
Length: 564
>GLEAN_7972 class=GenePrediction position=GCSC_113:1932710..1931795 (- strand)
ATGGTATGCTTTCACAAAAAGAAAGCAGCCCAAGATGTTTCAGTATTCTGCTACAGCATTTCTGTCGCTTGTTCTCAATG
GCGATCCCACCATGCAGTACAAAGACCCCGCACAAAGCACACAGTATTATATCAGCTCGCACTGTTTTTTATTAGCTTAC
GGAGTACAGGAGTATTAGCGGAATCGTGGATTAGTCATCCAAATTGGACGAAATCTAATACTGTTCAAAGTTATAGTGGA
CTAGTAACGCTTTCTTCCAATCCAAAAGTTCTGTAGCTCGACAGCCCCAGATGCCCTACAAGGTACACCAGCCATATGCA
ACGACTGTTCGCAACTTGCTCACACATAACAGACCAAAACGTCAGAAGTGAAGAAGCGGCTCCGCGAGAATCAGCGGGCC
TGCCGCGTCCGCCAGAAGGAGCTCATCGAAGACCTTCGTCGCAGAGTGCGAGAGCTCGAAGATCGTGGTATCCAGGCTAC
AAAGGAGATGCAGTGCACAGCACGTGCTGTGGAATGGGAAAACAACCGTCTGCGCGCCCTTCTATCTTCGCACGGCATCT
CAACTGGAGAGATTGACAACTTTCTGCGTCCCGAAACCAAGTCACATCTAGCTTGGGATCAAGGCACTGCTGCAGAAAGT
ACAGAACCCCACGTCATGGCACCTCAAAATGTCGGCCAGGTTTTCGCGGGTGATTTTACAGACCTGGGAGAACTACAGGC
CGAGAGTAGCATCACTCTTGCGCGAGAGCCAGCCACTATGGTCACGCTCTGTGACAAGGCGGCCAAGATCGTTGCCGAAG
CCCATGGACACAGGGATACTGAAGTTGCCCTCAATGCGCTTGGATGTGCTCGAAAGACAAAAGACTGCGTCGTGAACAAC
GTCAAGATATTTGATATTATTGGGCAGACGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62