GenePrediction:GLEAN_7975 Details

Name: GLEAN_7975
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1921424..1905622 (- strand)
Length: 15803
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1921424..1919797 (- strand)
Length: 1628
Type: CDS
Source: GLEAN
Position: GCSC_113:1919725..1905622 (- strand)
Length: 14104
>GLEAN_7975 class=GenePrediction position=GCSC_113:1921424..1905622 (- strand)
ATGACTCTCTACGATGTCGGACCGCAGCGACGGTCTCTGCTGGCCGACTCGGCCACCTGTGGGCTTTTCCCACCACAATT
GCTTCGCATAATACGAAGCGAGACGACGACGACAAAGCGACCGGCCGCGGACAACACGACGACAGAGACGACCGCGATAA
CGACAAGCGGCCAAGGGCCAGCGAGCTTTCTGGACGCGGTGGCACAAGCTGCACTTTTGCCACGCCTCACAGGGCCTCTC
TTCGGCCACTTCCGGCCGCTTTTTGCCGACATTTGTGCCCGCTGGCTGCTGCATGCTCGCCGTGGCGTCCGGGACGACAC
CGTGGTGGCCTCGTTTGCCCGGTTGCTTCCCCTGGCTCCGTATCTGTCGGTGCTGCTGGACCGGTATCTGGCCGAGACGG
ATGCGTCGTTGCTGGCTGAGAACGCCAGCTCGACACTCTCGACAGACCCTCAACCCGAAGATCTCTGCGCTCGCCTTTTG
GCCCTCTGGCGGCTCGTCCATTTTGATACCCCCGCCTATGGCTGCCTCGTCCCGGCCGACCTGCAGCAGTTCTTCCGCCA
CCGGTCGCCACCGGTGCGGCTTCTCGCTATCCGCCTCTTCGGCCTCGTCCATGCTGCCGCCGACTTCAAGACCGACGCGC
TGCTTCGACAGTTTGTGCATGAGCACGACAGCCTGGCGGCCGACATGGATGGCACTGAGATCGACTACACCTTTTTGACG
CTGCACGAGCACGCACGGTGTGACGAGTGGTGGAAGCGAGCGGACGCAATCAACGCAGAGATCGAAGCAGTAACACGGCC
AGACGATCCCGAGAGCACGCTGATCCTTCCGTTGACGCCGCTCGTGGCCGCATGGGGCCGAACGGTGGTGCCCCGATCGG
GCTTGTCGTCGTCGCCGCAGTCCCCCTCCTCAGCCTCAGCCTCCTCTCCATCCGCTCTCGTTCGCACGGCCGCCACGGTG
GCCAACCTGGAGGCTCTCGCCTGCCGGCTGCTGCAGACGGAACCGGTCCTGCTTCGTGGTCCTGCTGGTGCCGGAAAGAC
GTCGCTGGTGCGTGAAGCAGCACGGGCGCTCGGCATGGAGGCCAGGCTGGTGACGCTGCACCTCAACGAGCAGACCGACG
CCAAGACGCTGCTGGGCCTGTACACGACCGGAGCCAAGCCAGGCTCGTTTGAGTGGCGGCCCGGCATTCTGACGACGGCC
GTGCAGGAGGGCCGCTGGGTGCTGATCGAGGATCTCGACCGTGCGCCCACTGATGTCATGAGCACGCTGCTGCCGCTGAT
CGAGCGCCGTGCCCTCGTGATTGCGAGCCGCCGCGAGACCGTCCGGGCACCACGCAGCTTCCGGCTGTTTGCCACCGTGC
GCACAGCAGCCAACACCAATAACACCACTCGCTCCCTCCTGGGCGAGCGTCTCTGGCAGGTCCTGCCAGTGACACCACTG
CCGGCCGACCAGCTCGAGCAGATTTTGCGCGAGACCTTTCCGGCCCTGCACGCTCTCGTGCCCGACATCTTGGCCGTCTT
TGGCCGTCTGACGGGCTCGTCATCGGTCGAGCGACCGGCCACGCTGCGGGATCTGCTGAAATGGTGCCGACCCGACTGGA
ACACGTTCTCGGGAGTCGGACGGGGCCGGTTGCTGCCACCGTCTCGGAGACGGCCATGATCGACATCTTCCTCGATGCCG
TCGACTGCTTTGTCGGCAGCGCCAAGGACGAGCGTGTCCGCCTGGCGCTGGGTCTGCAGATCGCCCAAGCCCTGCGCATC
ACGCCCGCTGTGGCCGAGCACGCCCTGCTGGCCCACGAGCCGGCCCTGCGCGAGACCGAGCGGCAGCTGGTGGTCGGTCG
GGCGACGCTGTCCAAGGCCCGTCATGCTGTTGGTGTGCCTAGCTCGCGACTCTTCGCCACCACTGCCCATGCTCGCCGAC
TGCTCGAGCAGATTGCCGTGGCCGTGCAGCTGCACGAGTCGCTGCTACTGGTCGGCGAGACGGGCATCGGCAAGACGACG
GTGATCCAGCAGCTGGCCGCTCAGCTCGGCCGCCGGCTCGTCGTCGTCAACCTGTCGCAGCAGAGTGAGGTCGGCGACCT
GCTGGGCGGCTTCAAGCCTGTCAGCGCCCGCAGTTTGGCCGTGCCGCTGCGTGACGAGTTCGACGCCCTCTTTGCCGCCA
CCGGCATCTCGGCCGACCGCAACGAGCGCTACCTCGGTCGCATCGCCTCCAGTGTCGCCCGTGGTCGCTGGGCCGACGTC
TGTCGGCTGTGGCAGCAGGCACCCCGGATGTTTGACCAGATCGTCGAGAAGCTAGGGGCCGACACCGACTCTGCGGATAC
TACCGACACCACCAATCCGAAACGACGAAAGACGGAGTCGAAGCGCCGTGCTCTGCTCGATCTCAGGCCACGCTGGGACC
GGTTTGCCCGCCGGCTCGACCAGTTCGCCCAGCAGGTCGCCGGTGGTTCTGGCGCCTTTGCCTTTGCCTTTGTCGAGGGC
AAGATCGTCCAGGCTGTCCGCAACGGTGACTGGCTGCTGCTCGACGAGATCAACCTGGCTTCGCCCGACACCCTCGAGAG
CGTGGCAGACTTGTTGTCGACCGGTCCGGCTGACTGTCCAACCATATTACTGGCCGAGACCGGTGCCATCGATCGTGTCC
GCGCTCATCCCGACTTCCGCGTCTTTGGTGCCATGAATCCGGCCACGGATGTCGGCAAGCGTGATCTTCCTCCCGGATTG
CGCTCCCGCTTCACAGAACTGCATGTCGCCAGTCCCGATCGCTCCGTCCAGGACCTCGTGCCCATCGTCAAGACATATCT
GCGCGCCAATCCCCGTGCCACCGACCGTGTCGTCGAGCGCGTCGCCCGCCTCTACCTCGCCATCAAGGCTCTCGCACTCG
ACCGCCGCCTCGTCGACGGTGCTGGTGAGGTCCCCCACTACAGCCTGCGCACCCTCACGCGCGTGCTGCGATATGTCGAC
GACGTCGCCCCCAGCTATGGTCTCGACCGCGCCCTCTACGAGGGCTTCTGCATGGGCTTCCTCACCCTGCTCTGCCAGGC
ATCCGAGGATCTGGTCATGCCGCTGATCGTCCAGCACCTGTTTGGGACGGGGGTGGGTGCTGACATAAGCAAGAACAAGA
GTGCCGCCGCTCTTAACCGCCAGAGGTCGGTGCTGACTCAGCCGCCCCGTGAGCCTCCTTTGCATCCGGACGGCCGTACC
TACGTACGGTTCACCAGCACGGACGGTGCGCGCCAGTACTGGCTGCAGCAGGGTGCAGACGCGCTGCAGGAGCGTGCCGA
CTACATCCGCACGCCGTACGTGGAGCGCAACTTGCTCAACCTGGTGCGGGCCACTTCGACCGGCCGGTTCCCGATCCTGA
TCCAAGGCCCCACGTCGGCCGGCAAGACGAGCATGATCGAGTTTCTCGCACACTTTAGCGGCAACCGGTTTGTGCGCATC
AACAACCATGAGCACACGGACCTGCAGGAGTATCTGGGCTCCTACGCAGCCGGGCCCGACGGCCGTCTGCGCTTCCAGGA
AGGCGTCCTGGTTCGGGCCATGCGTCAGGGTCACTGGATCGTTCTCGATGAGCTGAACCTGGCACCGACCGACGTGCTCG
AGGCGCTCAACCGGCTTCTGGACGACAATCGTGAGCTGCTCGTGCCCGAGACCCAGGAGATCGTCCGGCCGCACCCTCGC
TTCATGCTCTTTGCCACCCAGAACCCGGCCGGTCTCTATGGTGGCCGCAAGGTGCTCTCGCGTGCCTTTCGCAACCGCTT
TCTCGAGCTGCACTTTGACGACATCCCCGAAGCTGAACTAGGCCATATCCTGCAGATGCGCTGTCGTGCCACCGCGCCGT
CCGACTGTGAGCGCATCGTCACCGTCTACCGCGAGCTCTCGCGCCTGCGCCAGACCAGCCGCGTGTTCGAGCAGAAGAAC
AGCTTTGCCACTCTGCGTGATCTCTTCCGCTGGGCCCTGCGTGAGGCCGACAACCGAGACCAGATCGCCGCCCATGGCTT
CATGCTGCTGGCTGAGCGCGTGCGCGACGACGACGAGCGTCAGGCCGTCCGCCGCGTCATCGAGACCGTCTTCCGGACCA
AGATCGACGTCGACCTGCTGTATGGGCCGGCTGCTCTGCCTTCCTCTCTCGCCACTTCCACCTCCGTCGTCTGGACAAAG
GCGATGCGCCGTCTCTTTGTCCTCGTCAGCCATGCTCTGCGCAGCTGCGAGCCTGTCCTGCTCGTCGGCGAAACCGGTTG
CGGCAAGACCACTGTCTGCCAGCTGCTGGCCGAAGCTGCTGGCCGTCCGCTGCATATTGTCAACGCCCACCAGAACACCG
AGACCGGCGATCTGATCGGGTCACAGCGTCCTGTTCGCAATCGAGCTGCCGTGTTGGCGTCCCTGCAGGCCAATGTGGAA
GAGGCATTGAGGGTGGCTGAGGATGGGAGTGCTCCGGCTTCCCACGAGGATACCCCCGAGGATACCCCCTCCCTCTCGTC
TCTCCTTCAACGATACCACACTCTCCCTCCTCCCGTCCTCGCCCGCCTACCTCCTGACTTGGTCGCCCGGATCAGCCGTG
ACGAACCCCGCAGTAAGGCCCTCTTTGAGTGGGCCGACGGCAGTCTTGTGCAGGCCATGCAGTCGGGTGCTTTTTTCTTG
CTGGACGAGATCTCGCTGGCCGACGACTCCGTCCTCGAGCGGCTCAATTCCGTCTTGGAGCCGCAGCGTCGCCTTCTGTT
GGCCGAGAAGGGCGCGGCCGAGACAGCGGCAGCCACGGTAGATGCTGCCGACGGCTTCCAGTTCCTCGCCACCATGAATC
CGGGCGGCGACTTTGGCAAGAAAGAGCTCTCGCCTGCGCTGCGCAATCGCTTCACCGAAATCTGGGTCCCAGCTCTGGCC
GACGGCGACGACGTCCACGCCATCGTCTCTGCCGTCTTGCGGCCGCATGTTCGCATCCTGGCTCCTGTCATTGTCGACTT
TGCTGCCTGGTTCAGCCGCAGCTTCGGCCCTGCTGCTGCTGGTTCTGCTGCTGGTTCTGCCTCGCCCTTTTCCATCCGCG
ACATCCTCGTCTGGGCTCAGTTCGTCAACCGTTGTGATCATCCTGAAGAGGCTGACACGGCGCTCGTCCATGGTGCTGCC
ACCGTCTTCATCGACGCCCTCGGCGCCAACCCGTCTGCCATGGTGTCGGCTGATCCGGCTGTCGCTGCCCAGCAACGTGC
TCTCTGTCTCACCCATCTCAACCACCTGCTTGCCGACCATCATGCTCGCAATCCACAGCTTGGCTCTGCCACTGTCACCG
CCACCGCCTCGCAGATCTATGCAGCTGAGCCTCACATCGAGACCACCGACAGCCACTTTTCCGTCGGCAGCTTCAGCATT
GAGCGAGTCACCAACAGTCCCAACGGCCTATCCACCTCCTCTTCCCTCCCCTTCGCTTTCGATGCTCCCACCACCCGCCA
AAATACCATGCGTCTGGTCCGCGCCATGCAGATCGGCCACAAACCCATCTTGCTCGAGGGCAATCCTGGCGTTGGCAAGA
CGACCCTGGTGGCCGCCCTGGCCGCTGCCTGTGGCCAGCCGCTGACCCGCATCAACCTCTCGGACCAGACCGACTTGATG
GACCTCTTCGGCACCGATGTGCCCGTGGAGGGCGCTGAGGCTGGCCGCTTTGCCTGGCGTGACGCTCCCTTTCTGCAGGC
CATGCAGCGTGGCGAATGGGTTCTGCTCGACGAGATGAACCTGGCCTCGCAGTCTGTCCTCGAGGGCCTCAACGGCTGTC
TCGACCATCGTGGTGAGGTCTACGTGGCCGAGCTGGACCAGACCTTCCGCCGTCACCCGGACTTCCGCCTCTTTGCCGCC
CAGAACCCACATCACCAGGGTGGTGGCCGCAAAGGCTTGCCCGCCTCCTTTGTCAATCGCTTTCTGGTCGTCTATGCCGA
CGTCTTCTCCGAGGCCGACCAGCTGTTGATTGCCCACCGTCGTTTTCCGGCTGTCCCCCCCCAAGTCGTTCGCCATGTCA
CAGCTTTTGTCGCCGCCCTCGAGCGCGAAACTGTCCTCCGTCGCTCCTTTGGCCTGCAGGGTTCCCCTTGGGAGTTCAAT
TTGCGCGACACTCTCCGCTGGCTTGAGCTGGCCTCTTCGACAGCCACCCCCTTTGCCGCTCTCTCCTCGTCAGCCCCCAA
CTTCCTCGACATTGCCATCCGACAGCGCTTCCGCACTGCCCGTGACCGTCGCGAGGTCCAGAGACTCTTTGCTGCCGCCT
TTGACGCCCCCCATCGCCCACACAGCCGTTATCACGCTGTCGGCTCAGCCACCGCCCAGATCGGTCTCGCATTGCTGTCG
CGCAGTCGTCTCAGCCAGCCAACCGCTGCCTTTCCCGGCTTCGACCCCCGTCCTCGTCTGGCCGAGCTCGAGTCCGTTTT
GCTGTGTGTCCAGCACAACCTGCCTTGCATCCTCGTCGGGCCTTCAGGCTGTGGTAAGTCTGCTCTCCTGCAGCATGTCG
CTGCTCTCGCCGGCAAGCCGCTCGTCGTCTTCCCGCTCAGTGCCGATGTCGATGCCATGGATCTCGTCGGTGGTTTCGAA
CAGGCCGATCCAGTTCGCGATGTGTATGCTGGCCTGGCCGATCTCAAGGACGTCTTGAACATCTTTCTGCTCGAACACGC
GGCTGATGAAAACAACAATGACCACGACCACCATGCTGCCACCCTCATGCAGGCTCTCGGCATCACCACCACCACCACTC
CCGACTCCGAGGCTGCACACTTTGCCCACGTCGCCGACTGCATTGGCCGCTTGGCCCCCCTCATCGACAGCCGCTCGCCA
CTCGCTGCCGCCCTAGAGGCTGCCCACGATCGCCTCCAACAGCCACTGACACTGGCCAGCCCGCGCTTCGAGTGGCTCGA
CAGCATCATCGTCCGTGCTGCCCAGGCCGGCCACTGGCTCGTGCTCGACAACGCCAATCTCTGCAATGCCTCCGTGCTCG
ACCGCCTCAACTCCCTGCTCGAGCGGCCCCAAGGCTTCCTCAGCATCAACGAGCACAGCCAACCCGATGGCGAGCCGCGC
ATTGTTGCCCTGCATCCCGATTTCCGCATCTTCCTCACTGTCGACCCACGCTATGGCGAGCTCTCGCGTGCTATGCGCAA
TCGTTCCGTCGAGATCTTTGTCGACCCTGACACGGGCTACAGCCTGTCGAGAGCAACCCATATCGACCACATCGCTCCTG
TTGAGGCTCGCCTGCTTCGCTTCCACGATCTTGTCCGCCATCCGGACCCCCTCTGGCTCGACAACCTGTCTCTCGACGAC
TCCGCCCTGCTGCAGCGCTTTTTCCACACCGTCAACGCCGGCCGTCTTCTTCGCGAAGCCGATGACCAGACTCGCTCCCG
TCTGCTGCTGCGTATCCGTGTCGCCCTCTCTTACCTTGGCATCGCTGAGGCTGCACCCTTGCGCAACGCTATCTTGCACC
AGTACACCCAGTTTTCTGACAGCGCCGCCCATCCCGACGCCCTGCTCGTCTATGACCAGCCGCTGCATCCTCTCCAGAAT
TCGCTGCTCGTCCAGTCGCTCATGTCGTCGTCCTCGGATCTTGGCGTCCTCCCCACTTGGCTCTGGTGGCTCGGCCTCTG
CTACCAGACCACCGCCCGCGTCTCCTTTGCGCTCGAGGACCTTCTCCTGCACCGCCAAAAGGCCGCCGGCCACCTGTCCA
AGCTCGGCCTTCTCAACCGCCTCCAGCGCTCCTCACTGGCTGCCCAGGTCGCCGTTGTTGCCCGCGACTCCACCGCCCCC
GTCTTTGCCTTCCTCTCCGAGACCATGAAGGAGCTGCAGTCATGCATGGTCGCCAGCGTCGACTTGGTTCGCACACAAAT
CGCCACAAATAGGGGAAAGGACGTCCGCCACCTGCTCAACGTCGCTTCGCACATCTGGTGGCAGACCCATGCCCTCACCA
CGCAGTCCAGCTTTGATGAGGCTCGCTTCCAGGCTCATCTCGGCCATAGCCGCTCGCTGCTCCGTGGTTTCAAGGCTGAC
ATGCAGGCCCTCCAGCACGAGGTCGAATCCGAGCTGCTCAAACCCGCAAACGTTTTGCTCACCTTTGTCGCCAACATGCT
GCATCGCCTCGCCCACGACTTCGCTGACGGCTTCAGCCTCTCCACCGGTCTCAGCATGAACCTCCTATGGCCGCTCTTCC
GTCCGACCCCCATCCCCGACGAGCCCGCCTTCCGCCAGGTCGTCGCCATGGAACGTCTGGCTGCTCGCTTCGATAACCTT
AAGTGGCGCGTTCCCAATGCGTCGGCTGTCGACCTCGGCCACGTCATCACCTCCCTGGCAGATGCCTATCGCCTACTGCG
TGTCGACAGCACCGACTCCGCCGCTCTCGTCCAAGCTGTCACCGATGAGATCACCTCTCTCGAGTCCCTCGTCGCCACTG
GCCAGGTTCCGTCTGTGCCGCTGTTTGCCGACGTCTTCGAGGCTGTGCGCCAGCTTCACGTCCTCTATGGCAACGCCGGC
CAGCTTGACGACCAGATCAAGACCCTCGTCCTCTCTGACCTGCCCACTTTTGCTCAGCTGCGTCTGCACGGCTCTGTCGG
TCCTGCCCACCAGCTGCAGGCCGTCGACTACCTCCTCAGCCAGCTCTCCGCTCTTCGGCCCTGGAGCGGCACGCTTTCCA
GCCAGCTCTTGCGCAAGTCCGAGCACGTTATCTCTTCATCTGCACTGGCCTCCCTCCGCTCACTCGAGAAGGAACTGCCG
CTCGTTGGCCGCCTGGTCACCCGTGCCTCTGCTTCGCTCTCGGCAGACCCCGTCGCCAAGCTGAACGACTCGCTCTGGGA
CCTTCTGTCTGCTGTCGTCTCGTGCTTTGACAACAGAACATCCGCCCAGGTTCAATCTGCTGACGGCACGGACGCCGCCT
CGCTCCAGACTCACGTCAGGGCTCTTCTCGATGCTGCCTTGGCCCATCCGCAGATCGCTCATGTGCACATCTCTGCAAGC
GGCTTGGTCATCGGATCCGACAACGTCTCTGTGCCCGCCGAGAAGCTCATCTGGCCGAACTTGGACAAGAGCCAGCTCAG
TCCCATCCTGCAGCAACACTTCCTGCCCGTCGTTCTTGCTCTGGCCGCCTCACGGCAGAGCAGCAACGTGCACATGCGCC
AGTCCCTCTCTGCGGTCGCCTGGGTCCAGTTCTCCGTCGGCTGCATCAAGCTGTACACGCCCGACAAGGTCTTTGATCCC
TTTCTCGAGTGGAGGACCGAGCAAGACTTCCACGCAACCCTGCGCGCCTCTCTTGTCGACGAGTCCGCCGCCCTCCGCCA
GTTCGAGCACGACTTTACCGCCCAGGACTCCACGAGCCTGCGCCTCAGCCTGGCCGAAGAGGACATCCGCGTGCTCGATG
CCGCTCTCGTCAGCCGCCAGGAAAACCAGTCCCAGCTGCAACTCGACTCGCCAACAAGCATCTACCGTCCGTCCAGCGGC
GGCGCTGCCGCTGAGCTTTCCCGGCTGCAAAAGGACGTCTTCAACCCAGTCCTCGACGTCACCGTCAAGGATGACATCAG
CTCTGCCCACTTCCGCATTCTCTCCTCGCTGCTCGCAGCCACAGGCACAGAGACGACCACGACAGAAGCCCAACAGGAGC
TCCAGCTGGTCCAGCACAACGTCGTCCGCCTAATCGAGCGCCTGCTCATGAGCCAATTCACGGCCTACCAGGATCTTGCC
GTCCCGGTGGCAAACCTGCTTCGCTGTCTCCAGCTTGGCCTCTCCCTCAGCGAGGCTGCAGCCATGGCACCAACGTCTGA
CAGCTCTACGCCGTGGCTTGGCGTGACACCCTTCTTGGGCGGCCATCCCATGGCCATCGAAGCCGTTTCGGCACCGCTGA
AGAAGACCTGGGAGTTCTTGCTGTTTGGAGGTGTATGCGCTTCAGTGGACGGACCCAGTGAGCTCAGCGATGCCGCCACT
TCGTCTGCCTTCTCGCCCCAAGGCCGCCGCTGTATTGCCGAGTGCTTCCACTACTTCTTCACCGAGTGGAACAGAAAGCT
TGAGGCTGATCGCATGGCCGAGGAGGCCAAGACCAACCTGTACCGCTTCCGCGGCAGCCAGGAGGACGAGGAAGAAATGG
ATGAGGCCGAGTTCAGCGAGCTCTTCCCAACTTATTCCGGCAACGAGGACAGCATCAGCACCAACAAGAAAACGCTGGCC
AAGTGGGATCTCTCGGCCGATGTCTCCCGCATCCACCGCGACATCCTGCAGCCGTCGCGGCCGCCCACAGACACCATCCT
CGACTTCTGCAAGACCATTGCGCGCAAGGCTGCCAAGGAGATCGATGTCGATGGCGTCCCGTCGAAGCAGGCCATTTCCA
ACAGCGAGTTCTTGCCCGCAACCCTGCTCGCGGTCGATGACACCCTGCGCAGCCTGCAAACCTCGGTCGTCGCCGCGAGC
TCAGGCAAGTTCAACTTTTATACCGACACAAACCTGCCCGAGGCTCGCAAGCTCGTCGCACTCGTCCACGAGGTCGAGGC
CAAATTCCGCAGTCTCCAGCGTGTGGACGAGATCGGCCACCTGCAGCCGCTGGCTGACGTCGTGCTCGGGTGCGAACGCG
TGCTCGAGCTCGAGTTCAGCGAGCCTCTGGCAAAGGGCATCACCATGGTCGAAAAGCTGCACGAGGCCCTGTATGAGTGG
CAGTTCCGCGGATACGCAAGCCGCCAGTACCTCACCCCTACGCTCTATGACCGCGTCACGGCCACGCTTGTCAGCTGGCG
GAAGCTCGAGCTGTCCACGTGGAGTCGCCTGTTCGACTCCGAGTCCGACAAGTGCCGGCAGGACGCGGGAGTCTGGTGGT
TCATCGCCTACCAGGCCGCCGTGGCTGGCCCCATGTCCATCCTTCTCGGCCAAGACGAAAATAGCAACAGCACCAGTAAC
TCGCTGGCTTACCATGTCGAGCAGCTGCTCAAGGAGCTCTCATCATACCTCTCCAGCTCTATCATGGGCCAGTTTTCAGC
GCGTCTCGACCTTCTCCGACAGATCGGCGCACATATCGGCCTGCTGATCCAAGATTACCCGGCCATGGCCGTGATCCAGA
ACGCCGTCAAGAATCTCGTTGCCTTCTACTCACGGTATGAGAGCAAGGCCATCGAGAGCGTCAAGAAGGGACGCGAGGGT
CTGCAGAAGAAGATGAATGACGTTCTCCTCCTGGCCAGCTGGCGCGACACCAACATCGACGCCCTTCGCGAGAGTGCCCG
CAAGTCCCATCTCAAGCTGTTCCGACTTGTCCGCAAGTTCCGGGCCGTACTCGGACAGCCGATGCTGTCCATCATCAAGT
CGGGACTTCCGGACGATGCGGAGCAGGAGATTGTACGCGGCAGCGAAGAGCTGGGTGCCGTCCTCGACTCGATCGACATC
GACCTGTCCCGGTCGCAAGCAGCGACCAAGTTGTGTGCAGACCTGATCCCTGACTGGGGCGATGATGCTCACACGCGCCG
TCTGGCCGGCGTGGACCGCATCGTATCGATCATGAACAGAGCTAGTGCCATTCCGGCTTCGACCCTGGATGCCAGCGATG
TTGTCTCTTCGTTTGTCAAGGACTTGTTGACGTCTATGTCTGAGCTGCGCAAGGAGACGCCTGGCCTGCTCACAGAGGAA
ACAAAGGACGCGGTCAAGCACCTAAAGACACGCAAGATTCGCCTCTTTGACGAGACCGTCAAGGCCGTGCGCCAGATGGG
CTTCAGCAGCAACCTGGGCACAAGCCGGCTGGCCGCACAGGCATCGCTGCCGCTGATCTTCTCGGGTTCATCGGGTCTGA
CAGCAATGCGGCTGCCCGAAGAGCTGGATTTTGCCGGCCTCGAGTACAGCTTCCACAAGCTGGTGGACTTGGCGCCGCAG
TTCCGCGAGGCCTTGTACGAGCACCACAGCGACCTCCAGAGGATCACGGCGCGGCGCACTGTCGGCTACCTAGAAGGCAT
CCTGTACGTTGCACTGCGGCAGCGTGAGATTCTGACAGCATCTGCCCGCAGCCTGTCTGCTCTCGATGCCCAGGTCGCAC
ATGTCGACAGCCTCAGCGCAAGCTTGGTCGATGACGGCAAGGGTGGCAACAAGAACGTCGCCGTCGAGACGTGTCGGTCT
GGCCATGCTCGCACATTGCGCTGGCTCGTGGCCATCACGCAGGTCGGCGTGCATCTCGCCGAGGTTCATGACCGGCTTGC
AGATGTTGACTGCAAGTCGGTTCGCACGCAGCTCGCAGCCTGGGCTTCCAAGTTCGATGGCTTGCGGATCAAGCTCGAGG
CCAGCCTTCCCGGTCTCCCAGACGGCTTTGTCTCGTCTGTGACTCTGGTACTTCGGTCTCAGATCGACGAGGAAGTCGCT
CGGTTTGCCTCTGAGCTGGAACAGCGCATAGAAGAGCGCCCGGACCTCGCGTACATTCTCCAGCAGATCAAGCTTTGGAC
TGTTGCCGACGCTTCGGACGAGGCGGAAAGGGCCATGACCGCGGCGGCAAGCGACGGATTGCCCTCCTTTACAGACAAGG
CGCTGGACCTGTCCAAGATGCTGCTCGACGCCGTGCAAAAGTTCAACAAGGCCGTGACGGAGTTACCAACATCGATCGAG
CAAACGGCGTGGCTGGTGGAATACAACGCCAAGCTCTCGACGGCCGTCAAATCGCTGCATGTGGACACGGTCCTGTCCAG
CATTCAGAAGTGCATCGATCTGCTGAGATGCAACTATAGCGCGCCACACTCGACGTCAGCCACAGCCCTTCTCTGCGTTC
TTCTGCCACTCCTGCAGCAGTACACGGCGACATTCCGGCGGACGCTGATGCGTCTTGCTGCTCTGCACCGGTCCACCTGC
CAGTTGGGCCACCGTCTGAGCCGAGCGTTTGTGGAGATTTCGTCACAAGGCTTCTGCACGCCGCCGGAGAAGTCAGACGA
CTCGTCTGGCCAGACCAACGGCAAGCTCGAAGAGGGCACCGGCCTAGGCGATGGCGAGGGTGCCGAAGACATCAGCAAGG
ACATCCAGCCAGACGAAGATCTGTCAGAATTAGCACAGACGGCCAACAAGGAGCAACAAGAGAAGGGCGACGGGATTGAG
GACGAAAAGGATGCCATCGATATGGGCAATGATGAGATGGAAGGCGAGATGGGGAGCGCGGCTGGCGACGATGAGGATGA
AGACAAGGACGGCGATGATAACGAAGGAGAGGATGAGGAGGACGACATGGACGAAGAAGCAGGTGATGTGGACGACCTTG
ACCCGACAGCGGTGGATGAGAAGATGTGGGATGGCGAAGATGCCAAGGACACGGAGAAGGAGCAGCAAGGAAACGAGTCC
AAGGGTCAGAAGAACGACGAAGAGCAGGTGGCGGCTGCGGACGACAAGTCGCAAAGCAAGGCTGCCGATGAAGCTGCGGT
CGGAGAAGAGGGCGGAGATGCAGAAGAGGAGAAGAAGGGCGAGGAAGAGGATGATGAGAAGAAAGAGGGAGACGATGGAG
ACGATGTGGATGACGATATCGGTTCGGATGACGAGCAAGTTGGCCCGCAACAGGAACTGAACCGCCAAGACCAGAACGTG
GAGGAGAATGATGCGCTGGATCTGCCTGACGACATGGAGTTGGATGACGGAGACGACAGCAATGACGGCGGTGGAGACGA
GCTGGACGACCTAGCCGATCTGGAAGAAGGAAAGGAGGAGGAGGGTGGCGTGGACGATTCGGCCCAGGAAGAGAAGCGTG
GAAAGGAGGAGGAGGAAGGGCCCGATGCGAAGAAAGAAGAAGAAGACGAGGCGATCGGTGATGAGACGGTCCAGACTGAC
AAGATGGCCGAAGACGACGAGGCCGAGAAGGATGAAGATAAGGAGGGTGATGATGAACAGAAAGACGGAGAGCAAGCGAC
AGAGGAAGACGGCATGGACGTGGACGAAGATGGCGACCAGGCGGAAGAGGCGCCAAAGCAGCCTCCGGTGAATGACGTGC
AGGCCGACAGCAAAGACACGGCCGCACCCAGCGACATGCAGAGTGGCGTCGGGCCGGAGCAGCAGGAGGACAACGCGGCC
GCCGACCAGGAACAGGCGGACCAGAACGAAAACAACAACAGTGCGAAGCGCGACCAGGGCGAGACGGGCCAGGATGCCGA
CGAGAAGGACACGATAGATGGTGGTGCCAACGGGACGATGACGAACCGCGACGCAGCCCAGCCAGAAGAGCCTTCGAGTG
CGGACAATGCAAACGAACAGCAGCAGCAACAACAACAGCCGTTCAAGAAGCTGGGCGACGTGTTGGAACGCTGGCATCGC
ACACAGCGCGAGATCAAGCAGGCCGAAGACGGGTCTCAAGACCAAGAGGTGCAAGACGAGAACAGCGCAGACCAGGCAGC
CGAGAAGGAGTTTCAGCACCTGCACGACGAGGAGGCAGTGGCCAGTACGCAAGCCATGGGCGCGGCCGACGACGATGAGG
CCCGACCGGTTAATGATGCCATGGCGATTGAGGATGAGGCCGACGGTGGCAAGAACGAAAAGAGCGAGGAGAAACAGACG
CAGCAGGCGAATGAGGAGAGCGATGATGGCAGCGATGTGGCCGAGGACGACAAGATGCAAGATGACGATGGTGATGATGC
GGATGACGATGGGGCTATGAAGACGGAGGGCGATGATGGTCAGGCCGGCGCGTCGATGCAGCGTGGCGCGTATGACGATG
TGGACGAGGATGATGGGGCCAGCAGCGACGGCGATCCGGACGAACAGGACGGAGTGGACCAGGAGAGCGAGTCGGACGAG
GAGGATGACGGCGCCAATGCGGACGAGGAGGCACTGCTGGCCACACAGCTGTTGTCGTCGACCCGACTCGAGGACGACGA
AGAGGGTGCCGAGCTGATGTCGCTGGACGAGGCCATGAGCCAGTGGACGGCCTTCCAGCAGTCGACTCACGGACTGTCAG
TCGCTCTGGCAGCCCAGCTGCGGCTGATCCTGTCGCCGTCGCAGGCGACCCGTCTTTCGGGTGGTTTCCGCACCGGAAAG
CGGTTGAGCATCCGCAAGATCATCCCGTATATTGCGTCGGGCTACAAGCGCGACAAGATCTGGATGCGACGCAGCGTCCC
GACAAAGCGGGCGTATCAGATTATGCTGTGTGTTGATGACAGCAAGAGCATGGCCGAGGCCGGAGCTTCAGCTTCAGCAT
CTGCTTCAGCTCTTTCACGCGTCTCGCCCGGCCATCTCGCCCTCAGCTCGCTCGTCATGGTCGCCCGCGCCCTCGCCATG
CTCGAGGCCGGCCAGGTCGGCGTTTTTGGGTTTGGTGCCCGCGTCTTTGCCGCTCACGGCCTCCTCGATGCCGAGCCGTT
TGGCGGCAGTGCTGGTGGTGGTGGTGCTGGCGGCGGACTCCAGGGCGCTGCTGCCCTCCGTCGCTTCACCTTCCGGCAGG
ACCGCACCGATGTGGCCCAGCTGTTGCGCACGACCATTGACACGTTCCGCCAGGCCCGCGAGGCTGCTCTCGGTGGCAGC
GCTTCCGCCGATCTCTGGCAGCTCGCTCTCGTGCTCTCGGACGGCCTCACGCCCTCGTCTGCCCACGAACGCATCCGCCG
GCTGCTCCGCGAGGCTGCCGAGTCCCGCATCATGATCGTCTTTGTCGTCCTCGATGGCCCTTCCGGCTCCTCGGCCTCTG
GCCAGCCGGCTGCTGACAGCGTGCTCGACCTCAAAGAAGCCAAGTTTGTCCGCGATCCTACCACCGGCGAAAACCGCGTC
GTCATCGAACGCTATCTCGACACCTTCCCCTTCCCCTACTACCTCATCGTCCACAACCTCGACGATCTGCCGGCTGCGCT
GGCCGGCTTGCTGCGCACCTGGTTTGCAGAGGTCAACTCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62