GenePrediction:GLEAN_7976 Details

Name: GLEAN_7976
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1891542..1890013 (- strand)
Length: 1530
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1891542..1890623 (- strand)
Length: 920
Type: CDS
Source: GLEAN
Position: GCSC_113:1890548..1890279 (- strand)
Length: 270
Type: CDS
Source: GLEAN
Position: GCSC_113:1890196..1890013 (- strand)
Length: 184
>GLEAN_7976 class=GenePrediction position=GCSC_113:1891542..1890013 (- strand)
ATGGCTAAGGCAGCCTGTGCTCTTGAGGCGGTGTCACGTTGGGCTGTCACGGGCACGCCGATTCAGAACCGCCTGGCTGA
TCTGGCCGCACTGCTCTCATTTATCAGGGCCCATCCGTATACAGATCCCAAAACGTTTGACGCTGACATTTCCCATCTCT
GGAAGTCGGGAGAAGAAGAGGAGGCTGCCAAGCGCCTGAAAAATCTCTCTGCATACCTGCTACTTCGCCGGCCGAAACAG
ATAATTGAGCTGCCCAGAAGATTGGACAGAAAGTGCACGGTTGATCTGTATCCAGAAGAGCGAGAGCTTTACAAAAGCAT
CCATGACCAAGTTCTTATTGAAATCGACGAGGCCATGCAGATGGGATCGGAAACATCTCGAGCAGCAATTTATGCTAAAA
CGCTGCAGAAGATTACCTCGCTACGACTCATCTGCGATCTAGGGTTGCATTACCGCGGAAGACATGCCGATAGCAGCAGT
AAAACTGCCAACTTCCAACCGGCTCTTTCAACGAAATCAGATTCAGAGGAAACACGGGAGGCTTCTCTACAAAGCATATT
TGACATGCGGCGTGATCTGGACGAAATCGAGTGCATTCAGTGCTCTTCACGATTTGGGCCAACGGATGCATTTCTGGGTG
ATGCCGTTTCTAAGCATCAAAATATGGCATGGTTCTCGCGCTGCCAAAAGTTCTTGTGCATCAGTTGTGTCAAAACGCAA
CGACAGGCCGAGATTAGCTTTCCATGTGGCCACCTGCCTCCCTGCCTAGCAGAAGCGGTGAATCCGTATCTGACTGAAGA
AGTGGCCGGCCATGAAGCTAAAGCATATACGTCCGAGGGCACTGACGATGTTGTGCGCTTGCCGTCCAAGGTGGAAGCAT
TGTTGTTGGATCTTAAAAGTCTACCGCCCAACACAAAATGGTAAGCGTCCTGGCCTCTGAACAGCTAAGAATCAGTAATC
GAAATACGACTAACATAATACCACTACTTGACAGCCTAATATTCTCGGCTTGGCGACTCACACTGGACGTGATCCAGAAA
GGTTTGGATCAGGCGTCCATTCAGAGTACCCGCTTTGACGGGGAAATACCACAAAAAGGGCGTCAGGCTGTCGTCGACAA
ATTCCGCAATGACCAGAACATCAGCGTCATGCTCTTAACTCTATCGTGCGGCGCTGTTGGGCAAGTGGTTTTTTGTTCGC
CCACTTTCTGTAGTCGAATGCTGACTTTATGTACTCTGCAGTCTGAATCTAACCGTCGCGACCCGTGCGTATCTCATGGA
GCCACATTGGTGAGAATTGGCATTTAGCAGCATAACGGTATAATTTCAAGCTCACACTATCGACAGGAACCCAACGCTGG
AAGAGCAGGCTCTGGCACGAATCCATCGTCTAGGCCAGACCAAAGAAGTCACCACTGTTCGCTTCTTCGCGCGAAACACA
TTTGAAGAGGCACGTCACACTCTTATTCTGTTCCTATTCGAGTTTGTCGATTTTCGCAGCTCCCTGCTGACCTTCCACAG
AAAGTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62