GenePrediction:GLEAN_7978 Details

Name: GLEAN_7978
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1876713..1874880 (- strand)
Length: 1834
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1876713..1876557 (- strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_113:1876445..1876162 (- strand)
Length: 284
Type: CDS
Source: GLEAN
Position: GCSC_113:1876076..1875860 (- strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_113:1875786..1875651 (- strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_113:1875594..1875301 (- strand)
Length: 294
Type: CDS
Source: GLEAN
Position: GCSC_113:1875242..1875055 (- strand)
Length: 188
Type: CDS
Source: GLEAN
Position: GCSC_113:1874995..1874880 (- strand)
Length: 116
>GLEAN_7978 class=GenePrediction position=GCSC_113:1876713..1874880 (- strand)
ATGGCCGTGCCTTTGTGGGAGACCATGGTGGAGATATGCCGGAAGATTCTCAAGGACTCTCTCAAACCAGAGTGGCTTCT
ATCAGAGAGCGAGCTGCCACCGGCTGACCAGCTCGATGTGTCCACGTTTATCGAAACTTGCAAGCGGCTGACGCCGCGTG
AGCTGGAGATCACCGCGAGGTCCGGCTCATCCCTGCTCGACCAGATGGCCGCCGGCTGACTGACGGCTGTCGAGACCGTC
ACCGTTTATATCAAGCGAGCACACATAGCCCACCAGCTGACCAACCTCGCGACCGAATTTCTGGTCGAGAACTCCCTGCG
AGATGCTGCTGAGCTGGACGCGTACTTTGCTAAGACGGGCAAGCTCATGGGGCCTTTGCACGGCATTCCCATCTCGGTCA
AGGAGCATGTCAACATGAAGGGCCGCATCTGTCATGCGGGCTACACGGCTTTTATCGATAATATTGCGTCCGAGGATGCA
GTGCTCCTCCAGCTCTTGAGGGCTGCCGGCGCTGTGTTCCACGTGCGGACTAACGTGCCCCAGTCCCTGATGGTATGTTT
ACATGCTTTTCCTGCCTTGATTGTTTCTGGGGTAAAAGAAGAAAGAAAAGAATAAAGAAACAAAGAAACAAATCAAGCAA
TTTGATTGCAGCAATTTGATATACGGCACGACAGTCAACCCTTTTAACCGCAAACTGACCAGCGGTGGCTCCAGCGGCGG
CGAAGGTGCAATCCTGGGCCTTCGCGGCTCCGTCTTGGGCATCGGCACCGACATTGGCGGTTCTGTCAAAGTCCCGGCAG
CTATCAACGGTGGCTATGGCCTGCAGCCTACAGCTCTACGAAATCCATTGATGGGTCTACAAAATGCCAGCCCAGGACAC
ATGGGCGTCTGGCCTATTATTGGGCCACTTGGCAAACAGCCTTGAAGATATTGTTCTCTTCCAGCAGGCTGTCATCGACC
AGAGACCGTGGGATATGGACTCCATGGTGGTTCCCCTGCCATGGAAGAGGCTTCAGCCAGCCGCAGCCAGGGACTTTACG
GTCGGTGTCATGTGGGATGACGGGTAAGCAGCGACGTCTGGGGTGGAGAAAAGAGTGAAAACAAATAACAATGTTCAAGA
ATCATCCACCCCCATCCACCCATCACTCGCGGTATGAAATACGCCGTAGAGAAGCTAGAGGCGGCCGGTGTCAAAGTTGT
CGACTTTGAGCCGCACCAGCATGAAGAAGGATGGGATGTTAGCAGACAGATGTACTTCCCCGACGGTGGCGCGAGAATTC
GACAGCTGCTGGCAGAAACCGGCGAGAAGCACGCATTTCTCACAGACGTCGCTCTGAACTGGGTCGAACAAACAGAACTG
ACCTCGAACGAGCTATCTATCCTGAAACTTCGGCGAGAGGGACTGTGGGCAAAGTACGTACTGGTTCTCATGCCTCATCG
TTCTTCTGACGTTCTTCTAACAATGCTTTAGCTACCATCAGCTAATGAAGGATCGCGGCGTTGACTTTATCTTGTGCCCA
AACTATGTCGGTGTTGCCCCTCTATTGGACCATTCTTGTCTCGCATGTCCCACTGGTCTCAAGGCAGACCCGGCCATCGA
TGTTGTCGGGTCTGATTACACCCCACGTTCGGCCGAAGATAGCCGAGACTACAAGACGTGTATGCCTTTTGCCCACGTTT
GCACAGTGGCAGAAACACTCCGGTTAACCTCCTTATAGATGTCCCTGAAGCATATGCTGGCGCTCCCATTGGCCTACAGT
TTGTGGGCAAGCGTTTCTGCGACGAGGAGACGGTTGCTGCGGCTTTGTTCGTATCGAAAATTGTCCAATCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62