GenePrediction:GLEAN_797 Details

Name: GLEAN_797
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:54792..56487 (+ strand)
Length: 1696
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:54792..55250 (+ strand)
Length: 459
Type: CDS
Source: GLEAN
Position: GCSC_132:55302..55581 (+ strand)
Length: 280
Type: CDS
Source: GLEAN
Position: GCSC_132:55637..56487 (+ strand)
Length: 851
>GLEAN_797 class=GenePrediction position=GCSC_132:54792..56487 (+ strand)
ATGCCCGACCGCGAGCAGGACGTGGCTGTGGCGGCAGCCCAAATCGGCACCATCAGGCCGTGGGAGAACAAGACTGTCCC
AGAGGACGACGCAGATGACGGCGGTGCGTTTCTGTCGCCGGCGGCCCGGCTGGCGAGCGAGACACATGAGTCACAGCTGC
AGACTAACGGCACGCGCCACACGGACACCGGAGACGGCGCAGCTGCATCGGCTGCCGTAGTCGACCTGCGTCCGCGCACT
ACCACCTCGACCAGGGAGATTGGCAGCACCATTGCCCGGCCGGGATCAGTGCGCATCAACGTCCAGGGCGCCTTCATCGT
CGAAGAAGAGGGGCGGGCGCGGTCTACATCGCCGGCCGAATCCTCCAAGGACGGGCGGGCTCACTCGCCGTCAGAGCACA
CAACCTTTGATATCCGGCTGCCCAACCACCATGCCGTTGTGTCGCACATTGCCGTGGACGTGAGTGCTGTCCAGGGCGAG
ATGTGGTGGTGGTAGATGCTGACAGAGCAGATTGGCGGAACCTTGGCCAAGGTGGTGTACTTTTCGCGTGACGTCCAGTC
CGAGCCTGGCGGCCGGCTCAACTTTATCAGCTTCGAGACCGACAAGATCGACGACTGCATCTCCTTTCTGGTCGACCTCA
AGAAACGCCACATTGCGGCCAACGGATCTGGCCTGGGCGAGCTCTGCGTCATGGCCACAGGCGGCGGTGCCTACAAGTAC
TACGACCTGATCAAGGCCCGCATGGGCACCGATGTGCATAGCGAGGACGAGATGGAGTGCCTGATCATGGGTGTGTGGAG
GCTGCTTGTGCCCCTGTTCGTCCCGTTCGCTTGCTGATCTTGTAGGCCTTGACTTTTTTATCACCGAGATCCCGCGTGAG
GTCTTTACCTACTCCGAGACCGATCCCATGCACTTTGCCACGCCAACCGACGACATCTATCCCTACATGCTGGTCAACAT
CGGCTCCGGCGTGTCCATGCTCAAGGTGTCGGGTCCGCACAAATACGAGCGCGTGGGTGGCACCTCGCTTGGCGGCGGCA
CGCTCTGGGGCCTGCTCTCGCTGCTGACGGGCGCCCGCTCCTTTGACGAGATGCTCGATATGGCCTCGCAGGGTGACAAC
TCCCGCGTCGATATGCTCGTCGGCGACATCTACGGCACCGACTACGGCAAGATCGGCCTCAAGGCCACCGCCATCGCCAG
CTCCTTCGGCAAGGTTTTCCGCATGAAACACGAGGCCGAGTCGGCCGCCGAGGACGGCCTTGGCTGCGGCGAGGACACGC
TGCTACCGCCTGACGGCCACTTTGCCAGTGCTGGTGATGGCCCTGGTGTTAGCGCTGCCGCCGCTGCCTCTGCGTCGACA
CGCAACACCCGCTTCTCCTCTGCAGACATCAGCCGATCGCTGCTGTACGCCATCAGCAACAACATTGGCCAGATTGCCTA
TCTGCAGTCGCAGATACACCAGCTGTCCAGCATCTACTTTGGCGGCTCGTTTATCCGGGGCCACCCCCAGACGATGAACA
CGCTGAGCTACGCCATCAAATTCTGGAGCAAGGGCGCCAGTCAGGCGTATTTTCTGCGGCACGAGGGCTACCTCGGCGCC
GTCGGTGCCTTTCTCAAACGCCAGCCACGCAACTGGGGCCGCCGTGGCAGCTTTGAGGGCTTAGAGATGCGTGTGGCCGA
GCGGCTGGCCGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62