GenePrediction:GLEAN_7980 Details

Name: GLEAN_7980
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1861994..1861067 (- strand)
Length: 928
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1861994..1861820 (- strand)
Length: 175
Type: CDS
Source: GLEAN
Position: GCSC_113:1861722..1861067 (- strand)
Length: 656
>GLEAN_7980 class=GenePrediction position=GCSC_113:1861994..1861067 (- strand)
ATGGAAGACATCACAGCAACCGTCGCCAAGGATGCCAACACCCTCAATGTCCCTCCCGTCAAGGATGTAGCTCCTGTGCC
CACCATTGGCGAGGTCGCTCCTGTGACTCCCGACTTTAAGCTGCCACGATCAAAGCCTACTGTGATTGTCTTCTTCCGTT
ATTGCGGTGACCCTTGTAGGTTTCTACCTTTTTGCCTTCTATCTCATCGTCAACGCTCCGACATTTTCCTCTCTCCTCTC
TCCTCTCTTCTCTCTTCCCCGCTAACCCTCAGTTTCCGAGAAAAACTTTCGCCAGCTCGCCGCCCTTTCGGTCCAGCAGC
CTGGCCTCGACTACATTGCCGTCTCGCTCTGCTCGCGCGAAGTCACCGACCGCTGGATCGAGAAGATTGGCGGCGCTTGG
AACACCGACGTCATCATCGACACCGAGCGCAACCTGTATGCCCGCTGGGGTCTCGGCCTGAACACCACCTGGCAGCTCTT
TAATCCCCGTGCCCTCTACACCACCGTCGCCCTTGGCCTCGAAGAGGGCATCTGGGGCCGCGCCGTCGACGACGGCGACC
GCTGGCAGATGGGCGGCGCCTTTGCTGTCGACGCTGCCGGCTTCGTCCGTTGGGTCCACGTCCCCGATGTCTCTGACGAC
GTCGTCGACTTCAACCCTATGCTCGACCTGTTCGGCCTGCCGAGAGTCAAGGGGCGCCGCCCGAAGAAGCCGGCAGAGGC
ACAATGGGTTGGTGCCGCTCACGGTGAACAGCCACAGTGGACAGGCGCCCTGAACGCTCCCCATGAACCCCGGGTCGCAG
CCACGGTGAAGGCTCACGGTGAGCGGCGAGCAGACATGGAGGATGCTCGCCCTGAACCCCGGCTCCCGCCCACGGTGAAG
GCTCACGGTGAACAGCGACCAGACCCGGTGGAAACGGACGAAAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62