GenePrediction:GLEAN_7981 Details

Name: GLEAN_7981
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1856734..1854302 (- strand)
Length: 2433
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1856734..1856621 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_113:1856518..1855466 (- strand)
Length: 1053
Type: CDS
Source: GLEAN
Position: GCSC_113:1855407..1854440 (- strand)
Length: 968
Type: CDS
Source: GLEAN
Position: GCSC_113:1854383..1854302 (- strand)
Length: 82
>GLEAN_7981 class=GenePrediction position=GCSC_113:1856734..1854302 (- strand)
ATGCCGACGCCCAGACGATCTTCTCAGCGGACTCGCCGGAACTCCTGGCGCAAGGAGACCACCGTCGATCTTCCAGACTC
TTCGCCATCGCGACCTGCAAAGCGAAGAAAGCAGGTAAGCAGCACTCGCTCGACTTCATTCGTCATCTCCCCATCCTATC
CCCTCTCCTCCAGCTGCCCCATGTACCCCTCCTTGTGCTCACGCTGTCCGTCTTAGGCGACCGACGAATCCCCGCGCGAC
ATCCCAGAAGAAGAACCGTCCAGCCTGCTGGCCGACAGCTCTGCCATCAACCCGACCGACGAGACCCAGATCGTGACCCG
TGTCGCCCAGCACCTCCTCTCTCCACACGAAGATCCCGTCCGTGCCAGCAAAGACCATTCCAACGCCATACATGAGGCCA
ATAAGGAGGGCGTTCAGGCGTATGCCAAGATTGCCGCACAGGACTGGACTTTCTACGTCACCAAGCTCACCGTCAACATC
GGCCGCACATCAGAGCCGCCGCCCGAGTATCCGAAGTTGTACGATCCCGATGGCGATCCCGAGTTTGTCCACATCGATCT
CGGACCAAGCAAGATGGTCTCGCGCCAGCATGCCCAGATCGTCTTCAACACGAAGAGCGAAAAGTGGTTCGTCCACGTCA
AGGGCCGAAACGGGGTGAAGGTCAACAACATGCCCTGGCGGCTGGGCCAGTCGAAGCCTCTCGGCAGCGGCGACGTCATC
GAGGTTGGCGGCGTGGAGATGATGTTTGTCCTCCCGCTCGAGACGAGTCCCTTGAACATCAACGACATCTACCTCCAACG
AGCCGGTTTTCCCAAGTCCGAACGCGAACCGTCGCATCTCGAAGAAACACCCTCTCGGCCACGGCTGCGTGCAACCACTC
CACAGGCTGCGGTCGAGTCGTCTCCGCGCGGCTCCACGATGCGGAGTGCCCTTCCCCGTGGCCAGCCAACTCCGCAGCCA
ATAGCCCCGGCACCGCCGGACTACAAACGACCAGGGACTCCACCTTCTGCTCGCAGCCGCATTTCCGTGCCCGGTTCCCA
CCTGAGGTCGCCCCAGTTTCGGGACATCCCAACCATGGTTGTCCATCCAAGCGATGTGGATCTCAGCCTGGACGAAAACA
AAAACATGAAGCCGCAGTACAGCTATGCCCAGATGATCACACAGGCCATCATGAACACCTCAGACGGGAAGCTCAACCTA
AATGGAATCTACAATTTCATCATGGACAACTACTCCTACTACAAGCACCAGCAGGCTGCCGGTTGGCAGGTGAGTCTGCT
TTGCCCCTTTTTTGTCGACGAATTTGGTGATATCTAACGCGGCTCAGAACTCCATTCGCCACAACCTGTCTCTCAACAAA
GCGTTTGAGAAGGTGGCACGGTCGACCGAAGAGCCCGGGAAAGGCATGAAGTGGTACATCTTGCCCGAGTACAAGGACGA
AATGGTCCGCACAGCCTATCGAGGAGGACGTGGTGGCCACCGGGGGTCCTCAAACCCGTCGTCGCCGAGCCAGCTGAACT
ACGTGAACCAGGGCCCGAGAGACATGGCTGCCAGGGATCTGGGATCTGCACGAAAGCGGAGAGTCTCACCGTCCGGGTCG
CCGCAGCCTCGATCCACCTTGCGCGATATGCACTTGACACCAGACCGAAGTTCGCGGCGACTGCTGCCCGACGAAGCCCC
GGCATCGTCCGACGGAAGCCCCCTCCCTCGATACCGAAGGGGCGCTGCCGCAAAAAGTGCCAGCAACAATGGCGGTAATG
CGGCGACGGCAGCGGCAGACGGATCCGCCCTCTCGACGGCCTCCGAATCGGTACCACGATCGCCCATTTTGACGTCGGCG
TTCCTGCAGGACGACACCGTCTCGTCTTTTGTCACGCCGGCACCGCATCGCGTTGAGCTGAAGCTGAACCCTCCGAGCAC
ACTGCAACGGCCCAGCCAGCACATGCCGACCAGCTCGCCGGCGCCTTTCTGGAAGTACGCCGACATCGGCAGCACACCGC
TGAAGTCAGCGGTGGCCTTCGATTTCAGCCCTTCCAAAACGACACAGAGAGGCAGAGGTGGCAGTGGCGCGCTGCCGGCG
AGCAGCAGCCCACCGCCTGCGGCAACAAGAACAAAGTCACCGTCATCCAGTCCGTCAAGACCGAGCCGAACCATCGTGCC
AGAACCAGCAGCAGAGCTGAAGGAGGCCGAATCGGCAACGAATACGACAGACTCGGAAACCGTCACGGACACAGCAGCTG
CCCTTCCTGTTCAAGCAGTCGACGTCGAGGAGGACGGCGGCTTTGACCTGACTAAGTGAGTCTAAGCCTCCTGCCACATT
TGTTGGATGCTTATGCTGACATGATCTACAGGGGCTTTCAAAGCATAGGCTCATATCATGCTCCAGTCCGGCACGGCCTG
CCTGTTGCAACGGCCATGAATGGGAATCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62