GenePrediction:GLEAN_7982 Details

Name: GLEAN_7982
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1838364..1834125 (- strand)
Length: 4240
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1838364..1838319 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_113:1838254..1838186 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_113:1838121..1838039 (- strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_113:1837985..1836329 (- strand)
Length: 1657
Type: CDS
Source: GLEAN
Position: GCSC_113:1836082..1834125 (- strand)
Length: 1958
>GLEAN_7982 class=GenePrediction position=GCSC_113:1838364..1834125 (- strand)
ATGGCGGCTTCTGCGGACCAGAAAGACGAGGCACAGGTTGCTGTTGGTTAGTATACCTCGAACGGCCTTCGGTCTGGGCC
TTCCCCGATGCACAGTTTGCTGAGACGTAGCAAAAGAGAGCAAGGCCGTGGCCGAAAATGCTGTCTCGGAAGAGATTGAG
GGTGGTGACCAAGTCGAAGGTATGTAGCATTGGCGATGGGACCATGACGTCGACCGATCGATCGGGGCTGACTTTGGATG
CAGACTCGCTGTACAACATCACGATTGTGCTGCCGCGCTCCGACGAGAAGCTATCGGTCATGGCAAGTGGCCCCCGGCCG
CCTCTGGTTGCCTCTGGCTGCCCCTTGTTCGTTGCTCCTGCTAACAGGCCCCTGTTCAGATCTACTCGAACGAGCAGGTG
GGCGAGGTCCGTCAGGCCATCATTGACTCGCCGGCGGCCCAGTACCACACGTGCTTCCACCTCGAATACAATGGCGAGCG
GATCAACGAGTTCGGGCAGATATCGGAGATCAAGGACCTGACGACCGAGGCCGAGATCCACGTGGTCGAGGATCCCTACA
CGGAGAAGGAGGCTCGGCTGCACGTGGTGCGGATACGGGATTTGATTGGAGCAGCTGGCGATCGGCCAGATGCGGTGCAC
GGCGTGCTTGCGGGACTGTCGCTCTTTGATAGCGTGACGGTCGAGTCGCTGGCGGCGGCCGAGGTGGCTCCGGTCGAGGC
AGACTTTGGGGCGGTGGCGGACGTGAACGTGCTGCTGCCCCGGGCGTCGGCTGAAGAGGCAGCGGGACCGAAGACGGTCA
AGGCGATCCAGCTCTCGCCGTGGAACCCGCCGCCAGTGTATTTGCGGCAAAAGGGCCACCTGATGTACCTGATCGTGACG
ACACTGGAAGGCGAGCAGTTCCAGATCACGTCGCACGTTGGCGGGTTTTACGTGAACAAGTCGTCCAACTCCAAGTTTGA
TCCGGGGATGCGGCCGGGCGCGAAGGCGTGCGTGTCGCACTCGCTGCTGGCGCTGATCGAGAAGATCTCGCCGTCGTTTG
CGGCGGTGTTTGCGGCGCTGCAGGAGCAGAACGGGCGACGAGACCCGCTGTCGACGTTCCAGATCACCAACGCGACGCCG
GCAGCTCCGTGGCTGGTGCCGGGGCCGACGACGGCAGCAGGATCGACATACGCACATGTGGCGGACATTACGCGGACGCA
GGAGTCGTTCCTGGTGGCCGGATCGGAGAGCGTGGAGAACCTGCGGGACTGGAACGAGGAGCTGCAGTCGGCACGCGAGC
TGCCACGCGAGACGGTGCAGGACCGGATCTTCCGCGAACGGCTGGTGTCCAAGGTGTTTGCCGACTACGTCGATGCGGCG
ACACGGGGCGCGATCCTGGTAGCCAACGGCGAGGTCGGGGCGCTCAACCCGACGGAGGACCGGGACGCGCAGATTTTTGT
GTACAACAACATCTTCTTCTCGTTCGGGGCCGACGGCGTGGGCACGTTCACGTCCGAGGGCGGCGACGAGGCCGCACGCA
TGGCCACGGGCAAGGATGTGGCCGGCGTCCGGCGGGTGAACCAGCTCGACATCGACGGGCTCTACTCACCCGGGACGGTG
GTGGTGGACTATCTCGGCAAGCGCGTGGTGGGCCAGAGCCTGGTGCCGGGCATCTTCAAGCAGCGTGAGCCGGGCGAGAA
CCAGATCGACTACGGGGCCGTGGACGGCAAGGATGTGGTGGCGGCAGATGAGCGGTTCGTCGAGCCGTTTGCGAAGCTGT
CGCAGGCACTCAGCGTGCGGCGCCACCCTGTCTGGGACAAGGATGGCCGGCGGGTCGAGCTGGAGGGCAGCGTCGAGACC
AAGGGTCTCATCGGCACCGACGGTCGCAAGTATGTGCTGGACCTGTACCGGATCACGCCGCTGGATGTGGCCTGGCAGGA
AGAGTCGGACGGACTGGCGGACGACGAGGCCACGGCGTATCCGCACCGGATGACGGTTCTGCGGCCAGAGCTGGTGGATA
TTTACTCGCGCGTCAAGATGCGGGAGTGGCTGGACGGTGAGCTTGCGAAGCGATCGAAGGGGGGTGAGAAGGGGGGTGAG
AAGGGTGAGGGTGAGGACAAGATTGAGGGCGAGGTGAAGGCTATCGAGGAAAAGACTGTCGAGCTTATCAAGGCCGAGGA
CGAGAAAGAAGAGAAGGAGGAAAGGGAGGAAAAGGAAGAAGAGAAGGAAGAAAAGGAAGAGAAGGAAGAAAAGGAAGAGA
AGGAAGAAAAGGAAGAAGAAGAGAAGGACAAAACAACCAAAGACGAACAGATGGACCGCATCGACGTGTCGGACTTCAAG
TTCTCGCTCAACCCGGACGTCTTCAGCGGTCAGGTGCCACAGACGGACGAGGAAAAGGAGCAGCTGGCAGCAGACGAAAA
GGAAGTGCGGGCAGTGTGCCAGCACCTGCGCGAAGTGTCGATCCCGGCTCTGATCTCCGACCTGAACGAGTCGGAGATCA
GCTTCCCGATGGACGGGCGGTCACTCAGCTCTCTGCTGCACAAGCGCGGCATCAACATGCGGTACCTGGGCCGGATTGCC
GAGCTGAGCAAGGCGCAGACACGTCTGGAGTGCCTGCACGTCGTGACGGTGCGCGAGATTGTGTCGCGGGCCTTTAAGCA
CGTGTCGGCCAAGTATCTGCGATACCTGCCGCAGCCGCTGAGCTCGGCGGCGATCGCGCACCTGCTGAACTGCCTTCTGG
GCAGCGGTCTGAACAGCACGCCGACGGCCTACGTGGAGCCATCGCTGCGGGGGATCTACGACGACGAGGACGTGGATGCC
GACGTGGACTTTAAGACGGTGACGCCAGCAAGCCTGAAAGCAGCCATCGAGGCCGAGGCGCTGCGGCGGTTCCGGTTCGC
GCTGCCGGCCGACTGGCAGTCGGAGTTGACGGGACAGCACCTGCAACTGCTGCGCGAGGTGTCGCTGAAGCTGGGACTGC
AGCTAGCCAGCAAGAAGTATGTCTTTACCGAGGCCGAGGCGAAGGAGACGGAGACAACCAAGACCAACGGCACAGCCACA
GCCTCAGCCACAGCCACATCATCAGCCACCACAGCCACAACAGCCGGCGAGGGCAGCAAGAAGAAGAAGAAGAAGGCAGC
GGCAGGCCGTGACGGGTCACCATCGTCACTAGACGAGGAGGCCAAGGCAGCGGCGACGCGGCCGGAACACACGTTCTGGC
CCGACGACATTGTCAACGTGGTGCCAGTGATCAAGGACTCGGCGCCACGCAGCGCGCTGGCCGAGGAGGCGATGGAAGCC
GGCAAGATTTCGCTGTCGCAGGGCCAAAAGAAGATCGGGCAGGAGCTGCTGCTGGAGTCGCTGTCGCTGCACGAGCAGAT
CTACGGGATCCTGCATCCGGAGGTGGCCCACGCCTACCACACGCTCGCGATGCTGTACTACCAGATGGACGACAAGGAAG
CAGCGGTCGAGCTGGCGCGCAAGGCGATCATCGTGTCGGAGCGGGTCATCGGACTGGACAGCCAGGAGACGCTGCTCAAC
TACCTGAATCTGGCCCTGTTTGTGCACCAGCAGGGCAAGAGCGCGCTGGGCCTGGCCTATGCCAAGCACGCGCTGCGCCT
GTGGCGCGTGCTGTACGGTCCCGACCACCCGGATGCCATCACGACGGTCAACAATGCGGCCGTGATGCTGCAGAGCATCA
AGGCGTACCACGAGTCGCGTCGCTGGTTCGAGGAGTCGCTGCGCATGTCCGAGGCCGTCTTTGGCCGCGCCTCGCTCAAC
TCGGCCACCCTGCTCTTCCAGCTGGCCCAGGCCTTGGCTCTGGATCAGGACAGCAAGGGCGCTGTTGCTCGCATGCGCGA
GAGCTACAACGTCTTCCTCGCCGAGCTCGGGCCCGACGACAAGAACACCAAGGAGGCCGAGAGCTGGCTCGAACAGCTGA
TCCACAATGCCGTCTCCATCGCGAAGCACGCCAAGCACCTCGAGACCCGTCGCATTCGCGCCGGCATCCGCTTCCCGCCC
ACATCCACCCCACGCAGCGATGGTGCCGGTGCCCGTGCCTCTGGTGTTGCTGCCCCGACTACGACGGCCGCTGCCGAGGC
TGCTGCCAAGCCCGCCCTCGACTCGCGCTCCATCGACGAGCTCATCCGCTTCATCGAGGGCACCGACAGCAAGAATGGCA
AGACCGGCGCCGGCAGCAGCAGCAAGAAGCGCGGCAGCGGTCGCGCAAATCCCAAACGGAGATCGGCCCCGACGGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62