GenePrediction:GLEAN_7984 Details

Name: GLEAN_7984
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1831007..1829524 (- strand)
Length: 1484
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1831007..1830836 (- strand)
Length: 172
Type: CDS
Source: GLEAN
Position: GCSC_113:1830761..1830442 (- strand)
Length: 320
Type: CDS
Source: GLEAN
Position: GCSC_113:1830387..1829524 (- strand)
Length: 864
>GLEAN_7984 class=GenePrediction position=GCSC_113:1831007..1829524 (- strand)
ATGGCCGTCCCGGGAAAAAAGCGGAAGAGAGACGGCGTCACTGGTGGAGACGCAAAGTCCAAGAAGAAGAAGGTGACGAT
CAAGGAGCCTTCAGAAAAGTCTCGTGCCAAGACAGCAAAGACCATCGAGGTGACAAGCATCATACAGCCACAGTTCTCAG
CTCCGGTAATAGGTATGTGTGCACACGCGCAGAGCCACCTGAGATCTCGTGTAGGGCTTGCTGACACATTGCAGCCACGA
CCCCAGGACTGGTCGTTCCCGATGCGATCGAGTTCGACAGCTTTGCCCAGACGAGCAAGTCTGCCAAATCTTTGTCCAAA
CGGTCTCGGCCGGCAAAGCCGTCGGCAGAGCTGCTCCTGCATTCATCCAGCCACCACACAGTCAACTACACCGGCAAAGA
AGACAAAGCACCGGGGAGCGGCGCGGCCCTGCGACACTACATTGGCGTGCTCGACCCGGCCACGGGACAGCTGCAGGTGA
TGGAGGCGAAGAAGATGGTGATCCGGGGAAGCGTACGTGCTCGCGAGGCGTCGGAAGATGCGATGCGCGGCGTGTCGGTC
AAGAGCGTGAGTACCCTGTCTTTCTGGTCTACTTCCCGGAACGCGCTCTCACACTCACAGACGATGATGGACCTGCGCAA
CGACCTGGGCCAGACGTTTGGCACGAAGAAAGCCAAGAAGGCGATCCAGGCACTGACGGAGAACGCGATCTCGACACGGA
AGCGGCGGGAGGACGGGACGTTTGAGGCGGTGGCGATGGGCGCGGCCGACCGGGCGCAGCTGCAGTCGATGCAGGCGGCA
ACGGCAGCCATGTCGACGCGGGACGAGCTGCGCGAGACGGTGGACCGGGCGAAGCCGATCCCGCGGGGCAACTTTGAGGC
GCAGGAGATCCAGGACGTGTATGTGGCGAGCGAGATGATCGGGGCAGACACGCTGGCGACGGTGCCGGTGCGCGACTGGC
AGGAGGCGGTGCGAGCAGGCGAAGACATCCAGCTGTACTCGCGCTTTGTGGCGCAGCGGGTCAACCAGGTGGCCGCGCGG
GCCGACGGGCTGGAACAGCTGCGCCTGCTGCGCTACCTCTACTGGGTCATCCTGTACTGGCAGGCAGCGCGGCCGGGACG
TGAGCGCGGCACTAAGCGACAGCCACCGCGCGAGAAGCTGCGCGAGATGATGGACGGTGCGCCTGAGGCGATTGTCGAGC
ACATCCGGCAGCGATTCTCGGACGGCGGGACGATCCGCAAGTTCCAGGCCGACCTGCTGATCACGCACTGCTGCGCCTTT
GCCTGCATCATCGATGGCTTCGAGGTCAACACGTACGACCTGCGCGAGGACCTCAAGCTGGAGCAGCAGCAGATTGCCCA
GTACTTTAGCGAGATTGGCGCCCGCAACAAGATTGTCAAGACGGACGAGGCCGTCAGCCACGTGGCCAAGCTGGCCCTGC
CGCTGCAGTTTCCCAACAACATGCGGATGCGGCGGCGGCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62