GenePrediction:GLEAN_7985 Details

Name: GLEAN_7985
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1828956..1827721 (- strand)
Length: 1236
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1828956..1828781 (- strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_113:1828705..1827721 (- strand)
Length: 985
>GLEAN_7985 class=GenePrediction position=GCSC_113:1828956..1827721 (- strand)
ATGCCTTTCAGCGAGCCGACGGTGCAGCTGAGCAAGCCGAACATTGGAGTGTACACGAACACGAAGCACGAGCTATGGAT
TGCGCCAGCTGAGCCATCTCTGGAGACGGTGCAGGCAGCAGGGGGGCTGAAGCCGGGCGAGGTGACGGTAGCGATCCGGA
GCACGGGCATATGCGGGTGAGCAGAGGTCTGCTGACAAAGCCAAGATATGGGAGAGCACACGCTGACGTTTTCGGGATGG
AATCTCGGCAGCTCGGACGTGCACTTCTGGCGACACGGCTGCATTGGGCCGATGGTTGTGACGGGAGACCACGTGCTGGG
CCACGAGTCAGCCGGCGAGGTAGTGGCAGTGCACGCAGACGGAGCGAAGGACCTGACGGGCACGACGCTCAAGGTGGGCG
ACCGGGTAGCGATCGAGCCGAACGTGATCTGCGGAGCGTGCACGCCCTGTCTGACGGGACGGTACAACGGGTGCGAGCGG
GTGCAGTTTCTGTCGACGCCACCGGTAGACGGGCTGCTGCGACGGTACGTCAACCACCCGGCGACGTGGTGCCACCGAAT
CGGCGACACGATGAGCTGGGAGGAGGGATCGATGCTGGAGCCGCTGAGCGTGGCGCTGGCCGGCATCCAGCGGGCGCGTC
TGGCCCTGGGCGACCCGCTGTTGGTGTGCGGCGCCGGACCGATCGGCCTGGTGACGGCGCTGTGTGTGCGGGCTGCTGGT
GCCTGTCCGCTGGTGATCACGGACATCGATGCCGGCCGGTTGGCCTTTGCGCAGAAGCTGATCCCGGGGATCCGAACGGT
GCAGCTGGCCGGAGGGCCGGCCGACAGCACGAAGACGCTCGATGAGCAGGCCGAGACGACAGCCAAGCGCATCGTTGCCG
ACGGCTTCGACGGTGTCGAACCGCTGCTCGCCATCGACTGCACCGGGGTCGAGAGCAGCGTGGCTGCTGCCATCTGGGCG
GTGCAGTTTGGCGGCCGTGTCTTTGTCATCGGCGTCGGCCGCAACGAGATGCGCATCCCATTCATGCGGGCCAGCGTGCG
CGAGGTCGACCTGCAGTTCCAGTACCGCTACTGCAACACGTGGCCACGGGCCATCCGGCTGGTGCAGAGCGGTCTCGTCG
ACCTCAAACCGCTGGTCACGCATCGCTTCCAGCTGGATGACGCCGTCGAGGCGTTTCGCACGGCGTCGGATCCGTCCACG
GGCGCCATCAAGGTACAGATCCAGAGCTTGGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62