GenePrediction:GLEAN_7986 Details

Name: GLEAN_7986
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1827086..1826280 (- strand)
Length: 807
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1827086..1826762 (- strand)
Length: 325
Type: CDS
Source: GLEAN
Position: GCSC_113:1826665..1826581 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_113:1826520..1826280 (- strand)
Length: 241
>GLEAN_7986 class=GenePrediction position=GCSC_113:1827086..1826280 (- strand)
ATGTCCTCTATCTCAACCATGCGGCCTCTTCTGCGTCCTTCTTCTCTCGCCGCACCGACGCGCCTGGCCCTGCGCCGCTC
GCCTCCCCGTCGCCTGCAGTCCTCCTCCTCCACCAGCTCCTCCACCAGCTCCTCTTCCTCCTCCACACCAGACGCTGCCG
CCAAGGCACGGCAGGCTGCTGTCGATGCCACCTCCAAGGCTGCTGAGGGCCTCTCGCGCGTAGCCTCGGCTGCTGGCCCT
GTCGTTGCCGGCGCTGCTCGCAACCTCACGTCTGCACTTGGTCGTGTTGGCGGTCGCACCGGCAAGTTCGTTGCTTTCAC
GGAACGTACGTCGATTTTCTGGCAAATGCGAATTTCGCTTTTCGCATTTGCCCCTCACCTTGTCCCCACACCAGACCCAA
ACTCACTCTTTCTTCCTGCAGGCTATACCCCGTTTGTCGTCTACTACTCGCGCGTCAGCCTCGAGCTGTCCCGGCTTGTC
TTCCAGTCCCAGAAGATGTTCCCTCCGTACGTTTTTACCTCTGGGCCGCTGCTCTGGACGGAATTGGTCTCGACTAACCC
ACACAGCCCCGTGAGCACGTTCCAGACCTACTTCCAGAACGCCTGGAAGCAGGTGCAGAACCCCGCCAAACTCTTCCAGT
CTCCGGCCGCCCTCCTGCAGCAGGCGCGCTCGTTGTCGCCGGTCCAGCTGGCCGCCGGTGGCGTCATCGCAGCTGAGTGC
CTCGGCTTCTTCACCGTTGGCGAGATCATCGGCCGGTTCAAGCTCGTCGGTTACCGCGGCGGTGCCGCTCACGGCAGCGA
GCACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62