GenePrediction:GLEAN_7987 Details

Name: GLEAN_7987
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1822815..1820725 (- strand)
Length: 2091
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1822815..1820725 (- strand)
Length: 2091
>GLEAN_7987 class=GenePrediction position=GCSC_113:1822815..1820725 (- strand)
ATGCCTGAACATGGCCGCCAGACCCCTCGGTCTCCCCAGCGCAAGGCTTTGCGTCCACAGAAGATCCAGGCACCTTCGTC
GCCCGGCGAGTCCAGTTCGGGCATCACGCGAACGGCCACGCCTGCAGCCTCGCGTGGAGCCGACGACAGGCGACGACGCG
AGGAGAGGATCCGGGCCTCCAGCAGCGCCAGTGGTCTTGCCCGGCCGCCAACCAGCGACCTGTCGGGCTCATCACCTGTT
CCTCCGCCGAATCCGGCTTCCCTGCCGCTGATACGAAGCCACACGCCCGGTCACCACTCGTCCAAGAGCCACGATCGGCG
CCGCAAGGCATCCGAGCTGTCGATTCGCCAGCGCTCGCAGTCGACGGTTGGCCCATCGGTTGCTGCTGCTGCTGCTGCTG
CTGCTGCTTCTGATCTGGGCAGCTACACCGATCCGAGCAGCTTTACCCAGCTGGCCTCGTCGCCCTCGTCGTCGACCTAC
TTTTCCATGGCGGTACCTCCTTCGACCAGCAAAACACCAGGACCACCAGGACCACCAGGCCCGCCACCACAGCCGCCATT
GGTCATCAGCCGAGCCTCGACACGGTCTCCCCACAGCGCACCGGCCAGCGAGCCCCGATCAGTACGCAGCGGATCGCCGA
CACGGACAAGAGCCCCGTCAGCCTCCTCGGGCAGCCGACGGCCGCTGGCCATGCGGTCAACATCGTCCATTGCCAGCAAG
CCAGGCAGCCAGGGCAACAACAGCAACATCGAAAGCGCGCCGGCAGCAGCACCACCCTCGACCGCATCCCGCTACGTGAG
CTCATCACGCGGACGGACACGCAGCATTGGCACCGATGGTGGCCGCACCAACAGTGGCGGAGCCTCGACGCCGACGATCA
ACAGGAACGGCACGGCCACAGCCACAACTACAGCCCCGAGCATTGTGCCGTTTCCGGCCCTGATCGACCCCAGCATGGCG
CCAGATGTGCCGTCAGCCCCGTCGTCAGGCATGTACTGGTCACGGGCACCAGTGTCGGGGGCCGGCCACCCGGCACTACG
CGCCCACACGGCCACGCTGATCGGCTCCAACGTGTACATCTTTGGCGGCTGCGATGCGCGGACCTGCTTCAACGAGCTGT
TCGTGCTCGACGCCGACGCCTTTTTCTGGTGGCGGCCACCGGTCGTCGGCGACGTGCCGCTGCCGCTGCGCGCCATGACC
TGCACGGCCGTCGGCAAGAAGCTGGTCGTCTTTGGTGGCGGCGATGGGCCCGACTACTACAACGACGTGTACGTGCTCGA
CACCACCACCTTTCGCTGGACGCGGCCGCGCATCGCCACCGACCGGCCCATGCCGTCCAAGCGCCGCGCCCACACCGCCT
GTCTGTACAAGAACGGCATCTACATGTTTGGCGGCGGTGACGGCGTCCAGGCCCTCAACGACGTCTGGCGCCTCGATGTC
AGCGACATGACCAAGATGTCGTGGAAACTGATCAGCGCCCCAACCATCGTCAGCTCGGGTGGCAGCTCGGCCAAGATTTC
CGGCTCAGCCACAACATCCTTAACCTCGTCTGCGCCTTCATCAACCACGACGCTCGGCCGTGATCGAGATCGAGACCGAG
ACCGAGACCGAGATCGAGACCGAGACACACAACCCCGACCCCGAGCCCGCGGCTACCATACGGCCAACATGGTCGGCAGC
AAGCTGGTCATCTTTGGCGGCTCGGATGGCGGCGAGTGCTTTAATGATGTCTGGGTCTACGACGTCGACACGCGCATCTG
GCGCGCCGTCACCATGCCGACGGCCTTTCGGCGGCTCTCGCACACCGCCACCATCATCGGATCATATCTCTTTGTCGTCG
GCGGCCACGACGGCACCGAGTACTCCAACGAGGTGCTCCTGCTCAACCTCGTCACCATGGTCTGGGACCGCCGCAAGGTC
TACGGACTGCCGCCCAGTGGCCGCGGCTACCACGGCGCCGCCCTGCACGACAGCCGCCTGCTGCTGATCGGCGGCTTCGA
CGGCACCGAGGTCTTTGCCGATGTTTGGATCCTCGAGCTGGCCGTCCACGCATACTACTCGCAGATCAGCCAGTTCACCG
TGAACGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62