GenePrediction:GLEAN_7988 Details

Name: GLEAN_7988
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1815804..1813033 (- strand)
Length: 2772
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1815804..1814837 (- strand)
Length: 968
Type: CDS
Source: GLEAN
Position: GCSC_113:1814688..1813495 (- strand)
Length: 1194
Type: CDS
Source: GLEAN
Position: GCSC_113:1813429..1813249 (- strand)
Length: 181
Type: CDS
Source: GLEAN
Position: GCSC_113:1813188..1813033 (- strand)
Length: 156
>GLEAN_7988 class=GenePrediction position=GCSC_113:1815804..1813033 (- strand)
ATGAAAGCTGCCTTCAAGTGGCTTGGCTCAAGTACCGAGAACCCCTCGAAGCCGGTTCCGCCCTCCTCTCGGCCATCTGC
TGTTACGACCGCCGCCGCCTCTGTGTCAAGTTCTGCCTCTGGTGGGACGGCCGTCGTCGCCACCACTTCTGCCCCTGCCA
GCAGCTGCCGCATCAGCAGTCGCCAGAATATCCACCGCGCTGTCATCGACAACATTCGCAGAAGTCCCAACGCCGTGGCC
TCTGATAATTCCAAAAATTGTTATCGCGTATCTTTTGACTCTCCTAGCCGAGTCCCCTCATCCTCTCCCGCCTCTACGCC
TCCATCTTCTTCCCCGTCCCCGCTGCTTCAGTCGTCGCTCTCGTTGTCTCCCACCCCTCAGCCTGCGACCCCCCACTCAT
CCTCGCCTGACGACGCCCAAGGGATTGCCTTCGCTCACGGCCACCCGTTCAAACACATTGACGACGACCACAGTTTGCCT
TCTTCACCCACTTCACCTGCCTCTCGGCAAACATTGGCTTCCTCGACCTCGTCACGCATCCCAGACCAGCCCTCTCCTAC
CCATCATCGCCTTCTTTCTTGCGATCGAGGTAGTGTTTGGACCTCTGCAGGTGGCGACGACGATCACCTTTTTCAGATTG
ACGATCCCACCACCTTTTCTCCGGAGCGCTCCAACGTCGGATTTGATCCGGATCTTGATCTTGACCTTGCCGTAAACAAC
GAAGGACCTTCCATCGCCGCTGTGCCTGCTTTAGATTTCGACATTGACATGACTTCCGGTCACTCTTTCGAATCGGCCAT
GGGCCGCGGCCGGCAAGACTCATTTGTCAGCGCTGGTCCGAAGCCTATTTCCATGATCAACCCAAACCGCGACCCCAACC
GGAACCGCCGCGAAAGTCTCGCCAATAGCCTGATGGGAGGCGGCATGAGCTGGGGAGGTTTGTCTGTGAGCAGTTTCATC
CGAGACGAGTAAGTCCACCTTTGCGCTGTCTCTTCCAATCGCTCCCCACGATGGAATATTATTTGCATTCTTTCGATGGA
TCCGACCTGGTCCGAGTCATTACCTCATCTCTACATATGAGTATACAGGGTCTGACTTTTTTTTTTTTACTTTTAGAATG
ATGGGTGTATCGATGGGCACGTCGCCTAACATAGCACACCAATCTCCATCTCTTCACTCCACCTCTTATCTTCCAAAGAT
GGAGGCCAACTTCATGCGCGATTTCATGTGCTGTGACCGGGTCTGGCCCACCATGCACGACCTGTTGCAGCATTACGAGG
AAAGCCATACCCGCCAGGCCCCTTCATCTTCCCGACACATGAGCGGTCCGTCGTTTGCTACGCCAGGAACCAACCAGCGC
TCTGCTGCAAACCAGCATCATGGGTCTGCAGCAAACATGGGTGTTACAGGACAGTCAAGCCTTCAGGTTCTGCAACATGC
AGGACAGATGGGGCAGTCTAACCGAACAGTATCTCCCAATACTGGTGTTGGCCTTGGTCTAGGCATTGGTGTCGGTGGCT
TTCAGCAACTGATTAGACAGCAAGTTCAGCAACCGTCGACTCAGCAGCAGCAACAGAATCAGCAACAGCAGCAACAGCAG
TCGACCCCAATCGCTCCTAAGCATCAGCAGCTGTCGCACTTGAATGATGAGCTAGATGCCGTGGGAGACATGGAGATGGA
CGACGCCGTCGGGCCCATGGATATGGATGACAACCAGCGAACAATCCAGCAAACGAGACAGCTTTTTGGGCAACAGCGAC
CCCAGCTAAGCCTCAACAGCCCTCACCAGGCGCTGCGCACGTCTACCCCAACAACGCCAGCAGCAGCGAATTTCGGCTTT
GCAAACAACCCTACTGTCTCGTCTGTAAATACGCCTACCCTCTCCACCCAGCAGGGCTTTCCGCAGCGGTCCCAGAATCA
ATTTTCCCACGAATCATCACCTGACGACATGGATGATGATGAAGTCCCTGGGATGCCTATGAAGATGAATTTAGGCAGCA
TGAACCTCGATGGCAACAATTTTGGCATGGGCTTTGCCAACAACCTCGGCGGTATTGACTTCAGCTGCATCAATGATCCT
GCAAAGAGCCTTTACAGCCCCAGCGGCGCGTCCACACCACAACTCAACCAACAGCTTGCTCAGCAACTTGCACAGTTTAA
TATCGACCAGGCTCAGTTCCCGCCTGGCACAGACACCACGGCACTTCTGCAACAGATGAGCGCTGCATTTTTACTGCCTG
AAGAGCCGAAGCCGTACAGGTGTCCAGTCATTGGTTGTGAAAAGGCATACAAGAACCAAAATGGCCTCAAGTACGCTGGC
CCTTACCTTGTTCTGCTCGTCTTTCCAACTCTTTGCTAACCACGGCCCGATCTAGGTACCACAAGGCCCACGGCCACGCA
ACGCAGCAGCTTCACGAGAACGGTGACGGCACGTTTTCCATCGTCAATCCAGAGACTTCGGCCCCCTATCCTGGCACTCT
TGGCATGGAGAAGGAGAAGCCGTTTAAGTGTGATGTTTGTGGTAAACGGTACAAGAACCTCAATGGGCTCAAATATGTAA
GTTTTCACACACTTCTTCCCATTGAATCGTGTGCACTTGAACTGACAACTTGGCAGCACAAGCAACATTCTCCAGCTTGC
GATCCTGAACTCCTGGCCCAGCAGCAAAACCTGCTTTCGACGATGGCGGCGACCCTTGGTCAGAATCAAATGAACCTTAA
CCTCGGCGGCATGTCAACACTGCCAAATATCGGCGAGGAGACCATGAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62