GenePrediction:GLEAN_7989 Details

Name: GLEAN_7989
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1806205..1804397 (- strand)
Length: 1809
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1806205..1805937 (- strand)
Length: 269
Type: CDS
Source: GLEAN
Position: GCSC_113:1805880..1805679 (- strand)
Length: 202
Type: CDS
Source: GLEAN
Position: GCSC_113:1805614..1804397 (- strand)
Length: 1218
>GLEAN_7989 class=GenePrediction position=GCSC_113:1806205..1804397 (- strand)
ATGGCCGAGGAACAGAAGCCCGTCGAGGTCCCCGCCGTTGAGGCACCGGCCGTTGAGCCCGTTGTCGCTGAGGCTACGCC
TGCTGTCGAGGTCGTCGCTGAGACCCCTGCTGCCGCTGAGCCGGTTGTTGAGGCTGCTGCCGTTCCCGTCGAGGCTGCTG
TTGAGGAGCCGGCTGCCGAGGCCGCTGCTGCCCCCGCCGAGGAGGTGAAGGAGGAGGTCAAGCCCATCGAGGAGGGTGTC
CTTGAGGCCAAGGGCACTAGCTTCCCCAAGTGAGTGAAGTTTCCGTCAACTCTATCAGTTCTCGTGCTAATACTCCTGGC
TACAGGAAATTTCTCTACACCAAGAAGTTCTTCTGGTTCGGCAACGATGCTCTGAGTGCAAAGGACCTGGCTGCATACGT
GAAGAGCGAAAAGGCAACGGATGTTGCCCACCACGTCATCTCGTGGGCTTCGGAGACCGGCAAGGGCCTTCTCCTCTACG
GCGAGAAGCCGGGCGACAAGTCTACTGCTCACGGTGTGATTCAGCTGGTATGTTCCATCAAGAACGTGGATCCACATGTT
CATTGCATAAGCTAACTTCTAATCCAACCAGGCCGATGCCTCTGAGCCGACTGCCGAGGGTACCCACAAGTTCCAGCTCA
CCTCGAAGGGCCACAAGCACATCTTCAAGGCTTCTTCCACTGCCGAGCGCGACAACTGGGTCAACCAGATCAAGGCCAAG
ATTACTGAGGCCAAGGAGCTCGCCGCTACCGTTGCTGAGAGCGAGGCCTACAAGAACACTCTTGCGTCTTTGAAGCCTGC
GAAGAAAGAGACCCCCAAGGAGGCTCCCAAGGAAGAGAAGAAGGAGGAGGCTGCTGCCCCGGTCGAGGCTGATGCTCCGG
CTGAAACTGAGGCCGAGACCGCCGAGCCCGCTGCCGCTGTTGAGGAGGCTCCTAAGGAGGCCCCCAAGGAGGAGGAGAAG
AAAGAGAAGAAGGAGGAGAAGGGACGCCGGTCTGCTTCGCGCAAGCGTGCTTCGATCTTCGGCAACTTCATTGGCAAGAA
GGACGACAAGAAGGAGGTCACCGAGCCTGAGGTCGTCAAAGAGGACGATGAAGAGGCTGTGGCTCCCGCCGAAGCTGTGG
CCGAGGAGGCTGCCGCTGCCCCTGCTGCCGAGGCCCCTGTCGTCGATGTCGAGGCCGCTGCTGAGGCCGCTGCTCCGGAG
GTTAAGAGCCCGTCTGCCAAGCGGGCCAGCATCTTCGGCAACCTTGGCTTCTCCAAGAAGAAGGTTGAGCAGGATAATGC
CCCGGCCCCTCCCGCCAAGGATGTTCCGGCCGATGCTGCTGTTTCGGAGTCTGCTCCGGTGATCCCGGCCGTCGAGACGT
CGGAGCCGCTGTCGACTGACGTCAGCGCTCCCATTGTTGAGTCCCCGGCCGAGGCTGCTGCTGAGGCTGCCCCCGTGTCC
GACAGCGAGACCAAGAAGGAGGTGAAGAGCGACAAGCGTAAGTCGACTCTGCCGTTCAACTTTGGCAGCAAGAAGGACAA
GTCCGACGATGAGGGCGAGAAGAAGTCGTCGCCGTTCTCCAAGTTCCGCGCCACTGTCCGCCTGAACCGGAAGGAGAAGA
CGCCGGCCAAGGCTGAGGAGACGGTCGAGGAGGCGGCTGCACCTGCCGAAGTCGAGGCTGAGGCTGCTGCCGAGACTGAG
GCCCCCGTCGAGGAGGCTGCTGCTGCCCCGGCTGAGGCCGCCGAGGCTGTCCCTGCCACCATTGCTGAGGAGGCTGCGGA
GAAGCCGTCTGTTGTCGCTGCCACTCCCCAGGTTGCTGCTACCGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62