GenePrediction:GLEAN_798 Details

Name: GLEAN_798
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:57563..59483 (+ strand)
Length: 1921
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:57563..57698 (+ strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_132:57766..58803 (+ strand)
Length: 1038
Type: CDS
Source: GLEAN
Position: GCSC_132:58879..59483 (+ strand)
Length: 605
>GLEAN_798 class=GenePrediction position=GCSC_132:57563..59483 (+ strand)
ATGGCTACCTCTTCGATGGCCCTGTCGCGCGCAGGGCTCATCGACCCGACAAAGCCAGCCACCTATCCGGTCATTCTGGG
CGAAGATATTCGCAGCAGCGGCAGCCCGTCCCAGCAGCTGTTCACCGGCATACGATGTGCGCTGAGGCCTGAATTCTGCG
AGATGCTCTGCATTGTCTTCTGTCGCTAACCGAGCCTTGCCAGACAACTTCAAGGCGAAGCAACTGACCGACAAATCAAC
GCAGCACACGTCTACCCTCACCAGCCGAAACAATGACGACGACGCCCGCTACGAGATTACCTTTCGGGACAACAGCGGCG
GCCGCTATGTCTACGCCGGACAGCGCGTGTCCAAGAACTCCAAATACGTCCTTGTGTTTGACCACAAGCGCCGCGTCTTC
ATCCTCCACCGCCTCGACTCCCTCTTTGTCATGAACATGACCGACACCCCGACCAACCACGACTCCGAAGCCCTGAAGAA
AAAATACCCGCATATTGGCGAGAACACTACCCGGCGACTACGGCAGCACCGTGGGAGTGGTGCGGGCTCTTCGCAGGCCG
TCCGACGGCCGCTCATCAAGAAGAGTGGCAGCGGGGGTGGCGGAGCTCTGCGGCCGATGCAGAAGCCCGTATCCCGGCCG
CCACCACGGCCGGCGTCTGTTCTGCGAAACTCACACGATGTCGTCAAGAAAAACACTGCGAGCAGTACTAGCAGCAGCGG
CAGCAGCAGTAAGAGCAGGTCGTCACTGCTAGAGCCGCCAGACCTCAGCCGTGAAACCAAGGCGTCCAAGGATGTGCGAC
TGAAGCGGGAGGACATGGTGGCGAAGGAAGCACAAGACAACCGTGACGCGCGAGACAAGGCCGCACGAGATGCGGCTCTA
CGAAAAACGAAAGCGGCCGCTCTGGCGGCCCGGCCACGAGAAGGAAGCAAGCTGTCGCAGGAAACGAGGGCATCACCGGA
CGTCAAGCCACGTGATGGTAGGGGAGAGCTTAAGGAGTCGGCAGCCAAGCCGATCGACATACGCACCAAAGACAGCAACA
AGACGTCCATCGACCGGTCTAAGAAGCCATTGTCATCGAAACCCAAGAACACCACCGGTAGGGACAAGGACGGAGAGGCT
GGCAAGAGCGTTTCCAGCACGCCGAGCTCGAAAGCGGCGGCAAGGTCACAGGAGCTGCCAAGGCCAACGCCCGAAGCAAC
GTCCCGCACCAAGTCTGCCCCGAAGAAGAAGAAGCAAGGCAGTTGGGAAGAGGACGAGGAGGAGGATGACGACGACGACG
ACGGTGACCTTGGCATCGTCATTGAATATCCGGAAGGACCATCCCACGGCGCCCGCGGCGGCCATGCATTTTCTGCCGGT
CGCGGTGCCGGTGGTGTTGGCGGCGGTACCTCCCAGGCCGCTGCCAAAGGGGTGCAGCTGCACATGCCCACGTTTTCCGA
GTTTCAGCAGGAGAATGCCGACGACAACGGAATGGAGGAGGTTGGTCCAGACGAAGACCTCGACGGTTTTTGGGACCCGC
GAGAAGAGGCTGCTGGCGGTGCAGAGGCCAGTGGTGGTGGTGGTGATGGTGGTATCGGTAACACGCTGGGAGTTCCAGCA
GCAACTCCGAGCCCGGCAGCGACACCGGAGCCAGAGCCGATGTTGTCGGTACCGCGGCCATCATCTTCACAGAGAGAACG
ACAGGCCCGCGTCAGCAATACGCCTCTCAGCAACGGTAACAGGCCCAAGGTCGCAGCGGCTGACGATGATGTCGACGAGC
TGGAGGAAGCTCTGCTAGAGGAGCTCAGGGAGGCCGAAGAAGCCGAGAAAAAGAAGCGGGAGGAGAGCGAGAGGAAAAAG
CGGGAAGAGGCCGCGCTGGAGGCACAGCTCGAGGCCGAGCTGATGGCAGAGTCGGAGAGCGAGATTAGCGAGGAAGAGTA
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62